#!/usr/bin/env python
# -*- coding: utf-8 -*-
"""This module contains functions for computing AnalyzeGeomotery.
"""
import os
from rna_tools.tools.pdb_formatix.PDBFile import PDBFile #resname_check_and_3to1, set_residues_bfactor
from rna_tools.rna_tools_config import PHENIX_BIN_PATH
from subprocess import Popen, PIPE
# directory where this script is
# files for some commands are also here
DIRECTORY = os.path.dirname(__file__)
[docs]class AnalyzeGeometry(object):
"""
Wrapper class for running clashscore
.. note:: Sequence is required to get the length to calculate % of corrent residues.
"""
def __init__(self, verbose=False):
pass
[docs] def run(self, name, verbose=False):
"""
Args:
name (str): the path of the file to wrap
verbose (boolen): be verbose
Returns:
float: score; % of Backbone torsion suites (# of them per seq)
Output::
----------Backbone torsion suites----------
Suite ID suite suiteness triaged angle
A A 3 !! 0.000 delta
G A 4 !! 0.000 epsilon-1
G A 11 !! 0.000 None
C A 20 !! 0.000 gamma
U A 25 !! 0.000 delta
A A 26 !! 0.000 delta-1
A A 29 !! 0.000 None
U A 30 !! 0.000 epsilon-1
G A 41 !! 0.000 delta
U A 42 !! 0.000 delta-1
A A 45 !! 0.000 delta
U A 46 !! 0.000 epsilon-1
U A 47 !! 0.000 delta-1
11 suites triaged and 0 incomplete leaving 35 suites
13/46 suite outliers present
Average suiteness: 0.490
13 # count lines after 'traged angle' and minus 3 (# of last lines)
test/1xjrA_M1.pdb
34.7826
Output for a perfect structure::
/Applications/phenix-1.18.2-3874/build/bin/phenix.rna_validate /Users/magnus/work/src/rna-tools/rna_tools/input/mq/5e3hBC.pdb
CGACGCUAGCGUACGCUAGCGUCG
AnalyzeGeomtery:: ----------Backbone bond lenths----------
All bonds within 4.0 sigma of ideal values.
----------Backbone bond angles----------
All angles within 4.0 sigma of ideal values.
----------Sugar pucker----------
All puckers have reasonable geometry.
----------Backbone torsion suites----------
0 suites triaged and 0 incomplete leaving 24 suites
All RNA torsion suites are reasonable.
Average suiteness: 0.766
"""
#cmd = 'phenix.rna_validate_1.8.1-1168 %s' % name
cmd = PHENIX_BIN_PATH + os.sep + 'phenix.rna_validate %s' % name
out = Popen([cmd], stderr=PIPE, stdout=PIPE, shell=True)
out = out.stdout.read().decode().strip()
c = 0
now_count = False
pdb_file = PDBFile(pdb_path=name)
seq = pdb_file.seq_from_pdb()
if verbose:
print(cmd)
print(seq)
print('AnalyzeGeomtery::', out)
for l in out.split('\n'):
if now_count:
c += 1
if 'triaged angle' in l: # #suiteID:suite:suiteness:triaged_angle'):
now_count = True
# if c = 0 it means that triagged angle was not even detected
if c:
c = c - 3
return round(c/float(len(seq))*100,4)
#return ','.join([str(out), str(out2)])
[docs] def cleanup(self):
pass
[docs]def main():
wrapper = AnalyzeGeometry()
fns = [#'test' + os.sep + '1xjrA.pdb', # <- gtp causes error
'../test' + os.sep + '1xjrA_M1.pdb',
#'test' + os.sep + '1xjrA_M500.pdb'
] # native, and M1 from rasp decoys
for f in fns:
result = wrapper.run(f, True)
print(f)
print(result)
wrapper.cleanup()
if __name__ == '__main__':
main()