rna-tools & geekbook

Warning

Proof of concept

G33KB00K - 🤓 eXtreme eXtendable note taking system for nerds/geeks (including scientists!) (= beautiful html generator of your markdown-based notes) docs: http://geekbook.rtfd.io

Marcin Magnus (mmagnus) & Pietro Boccaletto (akaped)

The code of the project can be found at GitHub (https://github.com/mmagnus/geekbook).

A neat way how to combine Emacs/Atom/Sublime editor + Markdown Syntax + Git + Html engine (bootstrap/python) to get the best notes-talking experience ever. Highly customizable with plugins written in Python. What’s the most important, under the hood it’s just a set of Markdown files.. you can do with them whatever you want, e.g. you can Pandoc (http://pandoc.org/epub.html) them to epub (that’s origin of “book” part of the name).

Draw VARNA-based image of RNA secondary structure

Type:

<pre>[ss:rna]
UUUCUGUAUAAUGCCGAUAAUAAGGUUCGGCAGUUUCUACCAAACAGCCGUAAACUGUUUGACUACAGUAA
((.(((((...((((((.........))))))........(((((((.......)))))))..))))).))
</pre>

Warning

Keep exactly the same syntax as in the example above and below.

The syntax:

<pre>
[ss:/name of your seq/]
/seq/
/ss/
</pre>
# ^ not <pre/> nor <pre>. Keep a new line after this syntax. So don't do:
</pre>
<pre>

but

</pre>

<pre>
# ^ this could be fixed at some point

Warning

This plugin will change your Markdown file, so make sure that your editor will detect this change and ask you to reload the file!

to get a VARNA-drawn image of secondary structure.