Quickstart

This guide will walk you through the basic usage of rna-tools.

Let’s get started with some examples.

fetch a structure from the PDB database

Example:

$ rna_pdb_tools.py --fetch 1xjr
downloading...1xjr ok

fetch a biologicaly assembly

Example:

$ rna_pdb_tools.py --fetch-ba 1xjr
downloading...1xjr_ba.pdb ok

or over a list of pdb ids in a text file:

$ cat data/pdb_ids.txt
1y26
1fir

$ while read p; do rna_pdb_tools.py --fetch-ba $p; done < data/pdb_ids.txt
downloading...1y26_ba.pdb ok
downloading...1fir_ba.pdb ok

$ ls *.pdb
1fir_ba.pdb 1y26_ba.pdb

get sequences of a bunch of PDB files

Example:

$ rna_pdb_tools.py --get-seq *.pdb
# 1xjr
> A:1-47
GGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
# 6TNA
> A:1-76
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAucUGGAGgUCcUGUGuuCGaUCCACAGAAUUCGCACCA
# rp2_bujnicki_1_rpr
> A:1-15
CCGGAGGAACUACUG
> B:1-10
CCGGCAGCCU
> C:1-15
CCGGAGGAACUACUG
> D:1-10
CCGGCAGCCU
> E:1-15
CCGGAGGAACUACUG
> F:1-10
CCGGCAGCCU
> G:1-15
CCGGAGGAACUACUG
> H:1-10
CCGGCAGCCU

in some more fancy way ;-)

$ rna_pdb_tools.py --get-seq \
          --oneline 3_bujnicki_1_rpr* \
          --color-seq --compact
_images/getseqcolor.png

get secondary structures of your PDB files

Python parser to 3dna <http://x3dna.org/>.

Installation:

# install the code from http://forum.x3dna.org/downloads/3dna-download/
Create a copy of the rna_x3dna_config_local_sample.py (remove "_sample") present in rna-tools/rna_tools/tools/rna_x3dna folder.
Edit this line :
BINARY_PATH = <path to your x3dna-dssr file>
matching the path with the path of your x3dna-dssr file.
e.g. in my case: BINARY_PATH = ~/bin/x3dna-dssr.bin

For one structure you can run this script as:

[mm] py3dna$ git:(master) ✗ ./rna_x3dna.py test_data/1xjr.pdb
test_data/1xjr.pdb
>1xjr nts=47 [1xjr] -- secondary structure derived by DSSR
gGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
..(((((((...((((.((((.....))..))..))).).)))))))

For multiple structures in the folder, run the script like this:

[mm] py3dna$ git:(master) ✗ ./rna_x3dna.py test_data/*
test_data/1xjr.pdb
>1xjr nts=47 [1xjr] -- secondary structure derived by DSSR
gGAGUUCACCGAGGCCACGCGGAGUACGAUCGAGGGUACAGUGAAUU
..(((((((...((((.((((.....))..))..))).).)))))))
test_data/6TNA.pdb
>6TNA nts=76 [6TNA] -- secondary structure derived by DSSR
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....
test_data/rp2_bujnicki_1_rpr.pdb
>rp2_bujnicki_1_rpr nts=100 [rp2_bujnicki_1_rpr] -- secondary structure derived by DSSR
CCGGAGGAACUACUG&CCGGCAGCCU&CCGGAGGAACUACUG&CCGGCAGCCU&CCGGAGGAACUACUG&CCGGCAGCCU&CCGGAGGAACUACUG&CCGGCAGCCU
[[[[(((.....(((&{{{{))))))&(((((((.....(.(&]]]]).))))&[[[[[[......[[[&))))]]].]]&}}}}(((.....(((&]]]]))))))

Warning

This script should not be used in this given form with Parallel because it process output files from x3dna that are named always in the same way, e.g. dssr-torsions.txt. #TODO

class rna_tools.tools.rna_x3dna.rna_x3dna.x3DNA(pdbfn, show_log=False, verbose=False)[source]

Atributes:

curr_fn report

get_ion_water_report()[source]

@todo File name: /tmp/tmp0pdNHS

no. of DNA/RNA chains: 0 [] no. of nucleotides: 174 no. of waters: 793 no. of metals: 33 [Na=29, Mg=1, K=3]

get_modifications()[source]

Run find_pair to find modifications.

get_secstruc()[source]

Get secondary structure.

get_seq()[source]

Get sequence.

Somehow 1bzt_1 x3dna UCAGACUUUUAAPCUGA, what is P? P -> u

get_torsions(outfn) str[source]

Get torsion angles into ‘torsion.csv’ file:

nt,id,res,alpha,beta,gamma,delta,epsilon,zeta,e-z,chi,phase-angle,sugar-type,ssZp,Dp,splay,bpseq 1,g,A.GTP1,nan,nan,142.1,89.5,-131.0,-78.3,-53(BI),-178.2(anti),358.6(C2’-exo),~C3’-endo,4.68,4.68,29.98,0 2,G,A.G2,-75.8,-167.0,57.2,79.5,-143.4,-69.7,-74(BI),-169.2(anti),5.8(C3’-endo),~C3’-endo,4.68,4.76,25.61,0

run_x3dna(show_log=False, verbose=False)[source]
exception rna_tools.tools.rna_x3dna.rna_x3dna.x3DNAMissingFile[source]

delete a part of of your structure

Examples:

$ for i in *pdb; do rna_pdb_tools.py --delete A:46-56 $i > ../rpr_rm_loop/$i ; done

go over all files in the current directory, remove a fragment of chain A, residues between 46-56 (including them) and save outputs to in the folder rpr_rm_loops.

get numbering of your structure and rename chains

Rename chain B in structure 4_das_1_rpr.pdb:

$ rna_pdb_tools.py --get-seq  4_das_1_rpr.pdb
> 4_das_1_rpr.pdb B:1-126
GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCACUAGUCUAGCGUCAGCUUCGGCUGACGCUAGGCUAGUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCA
$ rna_pdb_tools.py --edit 'B:1-126>A:1-126' 4_das_1_rpr.pdb > 4_das_1_rpr2.pdb
$ rna_pdb_tools.py --get-seq  4_das_1_rpr2.pdb
> 4_das_1_rpr2.pdb A:1-126
GGCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAAACCCGGCAACCACUAGUCUAGCGUCAGCUUCGGCUGACGCUAGGCUAGUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCA

edit your structure (rename chain)

Examples:

$ rna_pdb_tools.py --edit 'A:3-21>A:1-19' 1f27_clean.pdb > 1f27_clean_A1-19.pdb

or even:

$ rna_pdb_tools.py --edit 'A:3-21>A:1-19,B:22-32>B:20-30' 1f27_clean.pdb > 1f27_clean_renumb.pdb

or even, even, do rename X chain to A only for Chen’s pdb structures in the folder, in place (so don’t create a new file):

$ for i in *Chen*; do rna_pdb_tools.py --edit 'X:1-125>A:1-125' $i > ${i}_temp; mv ${i}_temp ${i}; done
# do only edit for Chen's pdb structures, in place.

extract part of your structure

Example:

$ rna_pdb_tools.py --extract A:1-4 13_Bujnicki_1_rpr.pdb
REMARK 250 Model edited with rna-tools
REMARK 250  ver 3.1.14
REMARK 250  https://github.com/mmagnus/rna-tools
REMARK 250  Sat May 23 14:54:05 2020
HEADER extract A:1-4
ATOM      1  P     G A   1     -16.883 -12.441   8.021  1.00  0.00           P
ATOM      2  OP1   G A   1     -15.777 -12.225   8.969  1.00  0.00           O
ATOM      3  OP2   G A   1     -16.752 -11.535   6.892  1.00  0.00           O
ATOM      4  O5'   G A   1     -16.882 -13.822   7.219  1.00  0.00           O
ATOM      5  C5'   G A   1     -16.092 -13.871   6.013  1.00  0.00           C
ATOM      6  C4'   G A   1     -16.314 -15.160   5.206  1.00  0.00           C
ATOM      7  O4'   G A   1     -17.723 -14.932   4.905  1.00  0.00           O
ATOM      8  C3'   G A   1     -15.788 -15.216   3.752  1.00  0.00           C
ATOM      9  O3'   G A   1     -14.461 -15.860   3.764  1.00  0.00           O
ATOM     10  C2'   G A   1     -16.841 -15.946   2.969  1.00  0.00           C
(...)
ATOM     84  O2    U A   4     -14.553  -5.285  -7.938  1.00  0.00           O
ATOM     85  N3    U A   4     -14.077  -5.583  -5.727  1.00  0.00           N
ATOM     86  C4    U A   4     -13.451  -6.130  -4.622  1.00  0.00           C
ATOM     87  O4    U A   4     -13.706  -5.737  -3.486  1.00  0.00           O
ATOM     88  C5    U A   4     -12.494  -7.167  -4.998  1.00  0.00           C
ATOM     89  C6    U A   4     -12.318  -7.489  -6.300  1.00  0.00           C

find missing atoms in my structure

Run:

$ rna_pdb_tools.py --get-rnapuzzle-ready input/1_das_1_rpr_fixed.pdb
HEADER Generated with rna-pdb-tools
HEADER ver 91ed4f8-dirty
HEADER https://github.com/mmagnus/rna-pdb-tools
HEADER Sun Mar  5 10:58:07 2017
REMARK 000 Missing atoms:
REMARK 000  + P B <Residue C het=  resseq=1 icode= > residue # 1
REMARK 000  + OP1 B <Residue C het=  resseq=1 icode= > residue # 1
REMARK 000  + OP2 B <Residue C het=  resseq=1 icode= > residue # 1
REMARK 000  + O5' B <Residue C het=  resseq=1 icode= > residue # 1
ATOM      1  P     C A   1     -16.936  -3.789  68.770  1.00 11.89           P
ATOM      2  OP1   C A   1     -17.105  -3.675  67.302  1.00 14.35           O
ATOM      3  OP2   C A   1     -15.666  -4.265  69.342  1.00 12.68           O
...

mutate residues

For example, to replace the first four residues of chain A into adenines and 13th A of chain B, run:

$ rna_pdb_tools.py --mutate 'A:1A+2A+3A+4A,B:13A' \
   --inplace output/205d_rmH2o_mutA1234-B1_inplace.pdb
_images/mutate.png

Input structure on the left, mutated structure on the right.

If, for whatever reason, the tool here does not do what you want, use the tool from MC-Fold|MC-Sym Pipeline (go there https://www.major.iric.ca/MC-Pipeline/ and scroll down to the Section: “RNA SEQUENCE MUTATION” at the very bottom of the page).

Moreover, you can also mutate interactively proteins and nucleic acids with PyMOL >2.

_images/pymol_mutate.png

Learn more here https://pymolwiki.org/index.php/Mutagenesis

If you want to mutate with PyMOL with command-line see this https://pymolwiki.org/index.php/Rotkit

add missing atoms

The tool is using the function:

RNAStructure.get_rnapuzzle_ready(renumber_residues=True, fix_missing_atoms=True, rename_chains=True, ignore_op3=False, report_missing_atoms=True, keep_hetatm=False, backbone_only=False, no_backbone=False, bases_only=False, save_single_res=False, ref_frame_only=False, p_only=False, check_geometry=False, conect=False, conect_no_linkage=False, verbose=False)[source]

Get rnapuzzle (SimRNA) ready structure.

Clean up a structure, get current order of atoms.

Parameters:
  • renumber_residues – boolean, from 1 to …, second chain starts from 1 etc.

  • fix_missing_atoms – boolean, superimpose motifs from the minilibrary and copy-paste missing atoms, this is super crude, so should be used with caution.

Submission format @http://ahsoka.u-strasbg.fr/rnapuzzles/

Run rna_tools.rna_tools.lib.RNAStructure.std_resn() before this function to fix names.

_images/rebuild_op1op2_backbone.png

Figure: (Starting from left) input structure, structure with rebuilded atoms, and reference. The B fragment is observed in the reference used here as a “benchmark”, fragment A is reconstructed atoms (not observed in the reference”). 201122

  • 170305 Merged with get_simrna_ready and fixing OP3 terminal added

  • 170308 Fix missing atoms for bases, and O2’

_images/fix_missing_o_before_after.png

Fig. Add missing O2’ atom (before and after).

_images/fix_missing_superposition.png

Fig. The residue to fix is in cyan. The G base from the library in red. Atoms O4’, C2’, C1’ are shared between the sugar (in cyan) and the G base from the library (in red). These atoms are used to superimpose the G base on the sugar, and then all atoms from the base are copied to the residues.

_images/fix_missing_bases.png

Fig. Rebuild ACGU base-less. It’s not perfect but good enough for some applications.

Warning

It was only tested with the whole base missing!

Warning

requires: Biopython

Selection of atoms:

  • posphate group (3x, OP1 ,P, OP2),

  • connector (2x O5’, C5’), /5x

  • sugar (5x, C4’, O4’, C3’, O3’, C1’, C2’), /10

  • extra oxygens from sugar (2x, O2’ O3’), for now it’s /12!

  • A (10x), G (11x), C (8x), U(8x), max 12+11=23

And 27 unique atoms: {‘N9’, ‘O2’, ‘OP2’, “O2’”, “O4’”, ‘C8’, “O3’”, “C1’”, ‘C2’, ‘C6’, “C5’”, ‘N6’, ‘C5’, “C4’”, ‘C4’, “O5’”, “C3’”, ‘O6’, ‘N2’, ‘N7’, ‘OP1’, ‘N1’, ‘N4’, ‘P’, “C2’”, ‘N3’, ‘O4’}.