
rna_pdb_toolsx - a swiss army knife to manipulation of RNA pdb structures


$ rna_pdb_toolsx.py --delete A:46-56 --inplace *.pdb

 $ rna_pdb_toolsx.py --get-seq *
 # BujnickiLab_RNApuzzle14_n01bound
 > A:1-61
 # BujnickiLab_RNApuzzle14_n02bound
 > A:1-61

usage: rna_pdb_toolsx.py [-h] [--version] [-r] [--no-progress-bar]
                         [--renum-atoms] [--renum-nmr]
                         [--renum-residues-dirty] [--undo] [--delete-anisou]
                         [--fix] [--to-mol2] [--split-alt-locations] [-c]
                         [--is-pdb] [--is-nmr] [--nmr-dir NMR_DIR] [--un-nmr]
                         [--orgmode] [--get-chain GET_CHAIN] [--fetch]
                         [--fetch-ba] [--fetch-chain] [--get-seq]
                         [--color-seq] [--ignore-files IGNORE_FILES]
                         [--compact] [--hide-warnings] [--get-ss]
                         [--rosetta2generic] [--no-hr] [--renumber-residues]
                         [--dont-rename-chains] [--dont-fix-missing-atoms]
                         [--inspect] [--collapsed-view] [--cv] [-v]
                         [--mutate MUTATE] [--edit EDIT]
                         [--rename-chain RENAME_CHAIN]
                         [--swap-chains SWAP_CHAINS] [--set-chain SET_CHAIN]
                         [--replace-chain REPLACE_CHAIN] [--delete DELETE]
                         [--extract EXTRACT] [--extract-chain EXTRACT_CHAIN]
                         [--uniq UNIQ] [--chain-first] [--oneline] [--fasta]
                         [--cif2pdb] [--pdb2cif] [--get-rnapuzzle-ready]
                         [--rpr] [--keep-hetatm] [--inplace] [--suffix SUFFIX]
                         [--replace-hetatm] [--dont-report-missing-atoms]
                         [--backbone-only] [--no-backbone] [--bases-only]
                         file [file ...]
Positional arguments:
file file
--version Undocumented
-r=False, --report=False
 get report
 for –no-progress-bar for –rpr
 renumber atoms, tested with –get-seq
--undo=False undo operation of action done –inplace, , rename “backup files” .pdb~ to pdb, ALL files in the folder, not only ~ related to the last action (that you might want to revert, so be careful)
 remove files with ANISOU records, works with –inplace
--fix=False fix a PDB file, ! external program, pdbfixer used to fix missing atoms
 fix a PDB file, ! external program, pdbfixer used to fix missing atoms
-c=False, --clean=False
 get clean structure
--is-pdb=False check if a file is in the pdb format
--is-nmr=False check if a file is NMR-style multiple model pdb
--nmr-dir make NMR-style multiple model pdb file from a set of files rna_pdb_toolsx.py –nmr-dir . ‘cwc15_u5_fragments*.pdb’ > ~/Desktop/cwc15-u5.pdb please use ‘’ for pattern file recognition, this is a hack to deal with folders with thousands of models, if you used only *.pdb then the terminal will complain that you selected to many files.
--un-nmr=False split NMR-style multiple model pdb files into individual models [biopython]
 get a structure in org-mode format <sick!>
--get-chain get chain, one or many, e.g, A, but now also ABC works
--fetch=False fetch file from the PDB db, e.g., 1xjr, use ‘rp’ to fetchthe RNA-Puzzles standardized_dataset [around 100 MB]
 fetch biological assembly from the PDB db
 fetch a structure in extract chain, e.g. 6bk8 H
 get seq
 color seq, works with –get-seq
--ignore-files files to be ingored, .e.g, ‘solution’
 hide warnings, works with –get-chain, it hides warnings that given changes are not detected in a PDB file
--get-ss=False get secondary structure
 convert ROSETTA-like format to a generic pdb
--no-hr=False do not insert the header into files
 by defult is false
 used only with –get-rnapuzzle-ready. By default: –get-rnapuzzle-ready rename chains from ABC.. to stop behavior switch on this option
 used only with –get-rnapuzzle-ready
 inspect missing atoms (technically decorator to –get-rnapuzzle-ready without actually doing anything but giving a report on problems)
--cv=False alias to collapsed_view
-v=False, --verbose=False
 tell me more what you’re doing, please!
--mutate mutate residues, e.g., –mutate “A:1A+2A+3A+4A,B:1A” to mutate to adenines the first four nucleotides of the chain A and the first nucleotide of the chain B
--edit= edit ‘A:6>B:200’, ‘A:2-7>B:2-7’
--rename-chain edit ‘A>B’ to rename chain A to chain B
--swap-chains B>A, rename A to _, then B to A, then _ to B
--set-chain set chain for all ATOM lines and TER (quite brutal function)
 a file PDB name with one chain that will be used to replace the chain in the original PDB file, the chain id in this file has to be the same with the chain id of the original chain
--delete= delete the selected fragment, e.g. A:10-16, or for more than one fragment –delete ‘A:1-25+30-57’
--extract= extract the selected fragment, e.g. A:10-16, or for more than one fragment –extract ‘A:1-25+30-57’
 extract chain, e.g. A
--fasta=False with –get-seq, show sequences in fasta format, can be combined with –compact (mind, chains will be separated with ‘ ‘ in one line) $ rna_pdb_toolsx.py –get-seq –fasta –compact input/20_Bujnicki_1.pdb > 20_Bujnicki_1 ACCCGCAAGGCCGACGGC GCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU
 [PyMOL Python package required]
 [PyMOL Python package required]
 get RNApuzzle ready (keep only standard atoms).’ Be default it does not renumber residues, use –renumber-residues [requires BioPython]
--rpr=False alias to get_rnapuzzle ready)
 keep hetatoms
 in place edit the file! [experimental, only for get_rnapuzzle_ready, –delete, –get-ss, –get-seq, –edit-pdb]
--suffix when used with –inplace allows you to change a name of a new file, –suffix del will give <file>_del.pdb (mind added _)
 replace ‘HETATM’ with ‘ATOM’ [tested only with –get-rnapuzzle-ready]
 used only with –get-rnapuzzle-ready
 used only with –get-rnapuzzle-ready, keep only backbone (= remove bases)
 used only with –get-rnapuzzle-ready, remove atoms of backbone (define as P OP1 OP2 O5’)
 used only with –get-rnapuzzle-ready, keep only atoms of bases

get RNAPuzzle ready

class rna_tools.rna_tools_lib.RNAStructure(fn)[source]

RNAStructure - handles an RNA pdb file.


string – path to the structural file, e.g., “../rna_tools/input/4ts2.pdb”


string – filename of the structural file, “4ts2.pdb”


list – the PDB file is loaded and ATOM/HETATM/TER/END go to self.lines

get_rnapuzzle_ready(renumber_residues=True, fix_missing_atoms=True, rename_chains=True, report_missing_atoms=True, keep_hetatm=False, backbone_only=False, no_backbone=False, bases_only=False, verbose=False)[source]

Get rnapuzzle (SimRNA) ready structure.

Clean up a structure, get current order of atoms.

  • renumber_residues – boolean, from 1 to …, second chain starts from 1 etc.
  • fix_missing_atoms – boolean, superimpose motifs from the minilibrary and copy-paste missing atoms, this is super crude, so should be used with caution.

Submission format @http://ahsoka.u-strasbg.fr/rnapuzzles/

Run rna_tools.rna_tools.lib.RNAStructure.std_resn() before this function to fix names.


Figure: (Starting from left) input structure, structure with rebuilded atoms, and reference. The B fragment is observed in the reference used here as a “benchmark”, fragment A is reconstructed atoms (not observed in the reference”). 201122

  • 170305 Merged with get_simrna_ready and fixing OP3 terminal added
  • 170308 Fix missing atoms for bases, and O2’

Fig. Add missing O2’ atom (before and after).


Fig. The residue to fix is in cyan. The G base from the library in red. Atoms O4’, C2’, C1’ are shared between the sugar (in cyan) and the G base from the library (in red). These atoms are used to superimpose the G base on the sugar, and then all atoms from the base are copied to the residues.


Fig. Rebuild ACGU base-less. It’s not perfect but good enough for some applications.


It was only tested with the whole base missing!


requires: Biopython

get sequence


$ rna_pdb_toolsx.py --get-seq 5_solution_1.pdb
> 5_solution_1.pdb A:1-576
class rna_tools.rna_tools_lib.RNAStructure(fn)[source]

RNAStructure - handles an RNA pdb file.


string – path to the structural file, e.g., “../rna_tools/input/4ts2.pdb”


string – filename of the structural file, “4ts2.pdb”


list – the PDB file is loaded and ATOM/HETATM/TER/END go to self.lines

get_seq(compact=False, chainfirst=False, fasta=False, addfn='', color=False)[source]

Get seq (v2) gets segments of chains with correct numbering


python rna_pdb_seq.py input/1ykq_clx.pdb
> 1ykq_clx A:101-111
> 1ykq_clx B:201-238

> 6_solution_0 A:1-19 26-113 117-172

Chains is {'A': {'header': 'A:1-19 26-113 117-172', 'resi': [1, 2, 3, ...,         19, 26, 27, ..., 172], 'seq': ['G', 'G', 'C', 'G', ... C', 'G', 'U', 'C']}}

Chains are in other as the appear in the file.


take only ATOM and HETATM lines.



$ rna_pdb_toolsx.py --fetch 1xjr
downloading...1xjr ok
rna_tools.rna_tools_lib.fetch(pdb_id, path='.')[source]

fetch pdb file from RCSB.org https://files.rcsb.org/download/1Y26.pdb

Returns: a path to a file

fetch Biological Assembly


$ rna_pdb_toolsx.py --fetch-ba 1xjr
downloading...1xjr_ba.pdb ok

or over a list of pdb ids in a text file:

$ cat data/pdb_ids.txt

$ while read p; do rna_pdb_toolsx.py --fetch-ba $p; done < data/pdb_ids.txt
downloading...1y26_ba.pdb ok
downloading...1fir_ba.pdb ok

$ ls *.pdb
1fir_ba.pdb 1y26_ba.pdb
rna_tools.rna_tools_lib.fetch_ba(pdb_id, path='.')[source]

fetch biological assembly pdb file from RCSB.org

>>> fetch_ba('1xjr')



$ for i in *pdb; do rna_pdb_toolsx.py --delete A:46-56 $i > ../rpr_rm_loop/$i ; done

go over all files in the current directory, remove a fragment of chain A, residues between 46-56 (including them) and save outputs to in the folder rpr_rm_loops.


rna_tools.rna_tools_lib.edit_pdb(f, args)[source]

Edit your structure.

The function can take A:3-21>A:1-19 or even syntax like this A:3-21>A:1-19,B:22-32>B:20-30 and will do an editing.

The output is printed, line by line. Only ATOM lines are edited!


$ rna_pdb_toolsx.py --edit 'A:3-21>A:1-19' 1f27_clean.pdb > 1f27_clean_A1-19.pdb

or even:

$ rna_pdb_toolsx.py --edit 'A:3-21>A:1-19,B:22-32>B:20-30' 1f27_clean.pdb > 1f27_clean_renumb.pdb

the library

rna_tools_lib.py - main lib file, many tools in this lib is using this file.

class rna_tools.rna_tools_lib.RNAStructure(fn)[source]

RNAStructure - handles an RNA pdb file.


string – path to the structural file, e.g., “../rna_tools/input/4ts2.pdb”


string – filename of the structural file, “4ts2.pdb”


list – the PDB file is loaded and ATOM/HETATM/TER/END go to self.lines

edit_occupancy_of_pdb(txt, pdb, pdb_out, v=False)[source]

Make all atoms 1 (flexi) and then set occupancy 0 for seletected atoms. Return False if error. True if OK


Replace OXP’ to OPX1, e.g (‘O1P’ -> ‘OP1’)

fix_with_qrnas(outfn='', verbose=False)[source]

Add missing heavy atom.

A residue is recognized base on a residue names.

Copy QRNAS folder to curr folder, run QRNAS and remove QRNAS.


QRNAS required (http://genesilico.pl/QRNAS/QRNAS.tgz)

Returns:chain ids, e.g. set([‘A’, ‘B’])
Return type:set

Get atom code from a line of a PDB file


Get atom coordinates from a line of a PDB file


Extract atom number from a line of PDB file :param * line = ATOM line from a PDB file:

  • atom number (int)

return A:3-21 B:22-32


Get remarks as text for given file. This function re-open files, as define as self.fn to get remarks.


r = RNAStructure(fout)
remarks = r.get_remarks_txt()
r1 = r.get_res_txt('A', 1)
r2 = r.get_res_txt('A', 2)
r3 = r.get_res_txt('A', 3)
with open(fout, 'w') as f:

remarks is

REMARK 250 Model edited with rna-tools
REMARK 250  ver 3.5.4+63.g4338516.dirty
REMARK 250  https://github.com/mmagnus/rna-tools
REMARK 250  Fri Nov 13 10:15:19 2020
Returns:report, messages collected on the way of parsing this file
Return type:string

Get residue code from a line of a PDB file


Extract residue number from a line of PDB file :param * line = ATOM line from a PDB file:

  • residue number as an integer
get_res_text(chain_id, resi)[source]

Get a residue of given resi of chain_id and return as a text

  • chain_id (str) – e.g., ‘A’
  • resi (int) – e.g., 1

Return type:



r = RNAStructure(fn)
print(r.get_res_txt('A', 1))

ATOM      1  O5'   G A   1      78.080 -14.909  -0.104  1.00  9.24           O
ATOM      2  C5'   G A   1      79.070 -15.499  -0.956  1.00  9.70           C
ATOM      3  C4'   G A   1      78.597 -16.765  -1.648  1.00  9.64           C
ATOM      4  O4'   G A   1      78.180 -17.761  -0.672  1.00  9.88           O
get_rnapuzzle_ready(renumber_residues=True, fix_missing_atoms=True, rename_chains=True, report_missing_atoms=True, keep_hetatm=False, backbone_only=False, no_backbone=False, bases_only=False, verbose=False)[source]

Get rnapuzzle (SimRNA) ready structure.

Clean up a structure, get current order of atoms.

  • renumber_residues – boolean, from 1 to …, second chain starts from 1 etc.
  • fix_missing_atoms – boolean, superimpose motifs from the minilibrary and copy-paste missing atoms, this is super crude, so should be used with caution.

Submission format @http://ahsoka.u-strasbg.fr/rnapuzzles/

Run rna_tools.rna_tools.lib.RNAStructure.std_resn() before this function to fix names.


Figure: (Starting from left) input structure, structure with rebuilded atoms, and reference. The B fragment is observed in the reference used here as a “benchmark”, fragment A is reconstructed atoms (not observed in the reference”). 201122

  • 170305 Merged with get_simrna_ready and fixing OP3 terminal added
  • 170308 Fix missing atoms for bases, and O2’

Fig. Add missing O2’ atom (before and after).


Fig. The residue to fix is in cyan. The G base from the library in red. Atoms O4’, C2’, C1’ are shared between the sugar (in cyan) and the G base from the library (in red). These atoms are used to superimpose the G base on the sugar, and then all atoms from the base are copied to the residues.


Fig. Rebuild ACGU base-less. It’s not perfect but good enough for some applications.


It was only tested with the whole base missing!


requires: Biopython

get_seq(compact=False, chainfirst=False, fasta=False, addfn='', color=False)[source]

Get seq (v2) gets segments of chains with correct numbering


python rna_pdb_seq.py input/1ykq_clx.pdb
> 1ykq_clx A:101-111
> 1ykq_clx B:201-238

> 6_solution_0 A:1-19 26-113 117-172

Chains is {'A': {'header': 'A:1-19 26-113 117-172', 'resi': [1, 2, 3, ...,         19, 26, 27, ..., 172], 'seq': ['G', 'G', 'C', 'G', ... C', 'G', 'U', 'C']}}

Chains are in other as the appear in the file.


take only ATOM and HETATM lines.


works on self.lines.


Use self.lines and check if there is XX line


Return True if is_mol2 based on the presence of `@<TRIPOS>`.


True if the file is an NMR-style multiple model pdb

Returns:True or Fo
Return type:boolean

Return True if the files is in PDB format.

If self.lines is empty it means that nothing was parsed into the PDB format.


Delete file, self.fn


TER 1025 U A 47 HETATM 1026 MG MG A 101 42.664 34.395 50.249 1.00 70.99 MG HETATM 1027 MG MG A 201 47.865 33.919 48.090 1.00 67.09 MG


Remove HOH and TIP3

rename_chain(chain_id_old, chain_id_new, debug=False)[source]

Rename chains

  • chain_id_old (str) – e.g., A
  • chain_id_new (str) – e.g., B
  • debug (bool) – show some diagnostics

pdb content (txt) self.lines is updated with new lines


Renum atoms, from 1 to X for line; ATOM/HETATM

set_atom_occupancy(line, occupancy)[source]

set occupancy for line

set_res_code(line, code)[source]
  • lines
  • code

path (str): The path of the file to wrap field_storage (FileStorage): The :class:Y instance to wrap

temporary (bool): Whether or not to delete the file when the File instance is destructed
Returns:A buffered writable file descriptor
Return type:BufferedFileStorage

‘Fix’ residue names which means to change them to standard, e.g. RA5 -> A

Works on self.lines, and returns the result to self.lines.

Will change things like:

# URI -> U, URA -> U
1xjr_clx_charmm.pdb:ATOM    101  P   URA A   5      58.180  39.153  30.336  1.00 70.94
rp13_Dokholyan_1_URI_CYT_ADE_GUA_hydrogens.pdb:ATOM  82  P   URI A   4     501.633 506.561 506.256  1.00  0.00         P
un_nmr(startwith1=True, verbose=False)[source]

Un NMR - Split NMR-style multiple model pdb files into individual models.

Take self.fn and create new files in the way:



This function requires biopython.

write(outfn='', verbose=True)[source]

Write `self.lines` to a file (and add END file)

  • outfn (str) – file to save, if outfn is ‘’, then simply use self.fn
  • verbose (Boolen) – be verbose or not



based on https://pymolwiki.org/index.php/Aa_codes


Collapsed view of pdb file. Only lines with C5’ atoms are shown and TER, MODEL, END.


[mm] rna_tools git:(master) $ python rna-pdb-tools.py --cv input/1f27.pdb
ATOM      1  C5'   A A   3      25.674  19.091   3.459  1.00 16.99           C
ATOM     23  C5'   C A   4      19.700  19.206   5.034  1.00 12.65           C
ATOM     43  C5'   C A   5      14.537  16.130   6.444  1.00  8.74           C
ATOM     63  C5'   G A   6      11.726  11.579   9.544  1.00  9.81           C
ATOM     86  C5'   U A   7      12.007   7.281  13.726  1.00 11.35           C
ATOM    106  C5'   C A   8      12.087   6.601  18.999  1.00 12.74           C
rna_tools.rna_tools_lib.edit_pdb(f, args)[source]

Edit your structure.

The function can take A:3-21>A:1-19 or even syntax like this A:3-21>A:1-19,B:22-32>B:20-30 and will do an editing.

The output is printed, line by line. Only ATOM lines are edited!


$ rna_pdb_toolsx.py --edit 'A:3-21>A:1-19' 1f27_clean.pdb > 1f27_clean_A1-19.pdb

or even:

$ rna_pdb_toolsx.py --edit 'A:3-21>A:1-19,B:22-32>B:20-30' 1f27_clean.pdb > 1f27_clean_renumb.pdb
rna_tools.rna_tools_lib.fetch(pdb_id, path='.')[source]

fetch pdb file from RCSB.org https://files.rcsb.org/download/1Y26.pdb

Returns: a path to a file

rna_tools.rna_tools_lib.fetch_ba(pdb_id, path='.')[source]

fetch biological assembly pdb file from RCSB.org

>>> fetch_ba('1xjr')
rna_tools.rna_tools_lib.fetch_cif_ba(cif_id, path='.')[source]

fetch biological assembly cif file from RCSB.org

rna_tools.rna_tools_lib.load_rnas(path, verbose=True)[source]

Load structural files (via glob) and return a list of RNAStructure objects.


rnas = rtl.load_rnas('../rna_tools/input/mq/*.pdb')
rna_tools.rna_tools_lib.replace_chain(struc_fn, insert_fn, chain_id)[source]

Replace chain of the main file (struc_fn) with some new chain (insert_fn) of given chain id.

  • struc_fn (str) – path to the main PDB file
  • insert_fn (str) – path to the file that will be injected in into the main PDB file
  • chain_id (str) – chain that will be inserted into the main PDB file

text in the PDB format

Return type:


rna_tools.rna_tools_lib.set_chain_for_struc(struc_fn, chain_id, save_file_inplace=False, skip_ter=True)[source]

Quick & dirty function to set open a fn PDB format, set chain_id and save it to a file. Takes only lines with ATOM and TER.


Sort the given list in the way that humans expect. http://blog.codinghorror.com/sorting-for-humans-natural-sort-order/

PDB Edit Bfactor/Occupancy

rna_pdb_edit_occupancy_bfactor.py - edit occupancy or bfactor in PDB file.


rna_pdb_edit_occupancy_bfactor.py --occupancy --select A:1-40,B:1-22 \
                                 --set-to 0 \

rna_pdb_edit_occupancy_bfactor.py --occupancy \
                                  --select A:1-2 \
                                  --select-atoms P+C4\' \
                                  --set-to 10 \
                                  -o test_data/3w3s_homologymodel_out.PD
                                  --set-not-selected-to 8

usage: rna_pdb_edit_occupancy_bfactor.py [-h] (--bfactor | --occupancy)
                                         [--select SELECT] [--set-to SET_TO]
                                         [--set-not-selected-to SET_NOT_SELECTED_TO]
                                         [-o OUTPUT] [--verbose]
                                         [--select-atoms SELECT_ATOMS]
Positional arguments:
file file
 set bfactor
 set occupancy
--select get chain, e.g A:1-10, works also for multiple chainse.g A:1-40,B:1-22
--set-to=1 set value to, default is 1
 set value to, default is 0
-o, --output file output
 be verbose
--select-atoms select only given atomscan be only one atom, e.g. Por more, use ' for prims, e.g. P+C4'
rna_tools.tools.rna_pdb_edit_occupancy_bfactor.rna_pdb_edit_occupancy_bfactor.edit_occupancy_of_pdb(txt, pdb, pdb_out, bfactor, occupancy, set_to, set_not_selected_to, select_atoms, v=False)[source]

Change ouccupancy or bfactor of pdb file.

Load the structure, and first set everything to be set_not_selected_to and then set selected to sel_to.

  • txt (str) – A:1-10, selection, what to change
  • pdb (str) – filename to read as an input
  • pdb_out (str) – filename to save an output
  • bfactor (bool) – if edit bfactor
  • occupancy (bool) – if edit occupancy
  • set_to (float) – set to this value, if within selection
  • set_not_selected_to (float) – set to this value, if not within selection
  • select_atoms (str) – P, P+C4’, use + as a separator
  • v (bool) – be verbose

if OK, save an output to pdb_out

Return type:



this function requires BioPython

Add chain to a file


./rna_add_chain.py -c X ../../input/1msy_rnakbmd_decoy999_clx_noChain.pdb     > ../../output/1msy_rnakbmd_decoy999_clx_noChain_Xchain.pdb


ATOM      1  O5'   U     1      42.778  25.208  46.287  1.00  0.00
ATOM      2  C5'   U     1      42.780  26.630  45.876  1.00  0.00
ATOM      3  C4'   U     1      42.080  27.526  46.956  1.00  0.00
ATOM      4  O4'   U     1      43.013  28.044  47.963  1.00  0.00
ATOM      5  C1'   U     1      42.706  29.395  48.257  1.00  0.00
ATOM      6  N1    U     1      43.857  30.305  47.703  1.00  0.00
ATOM      7  C6    U     1      45.057  29.857  47.308  1.00  0.00
ATOM      8  C5    U     1      46.025  30.676  46.763  1.00  0.00
ATOM      9  C4    U     1      45.720  32.110  46.702  1.00  0.00
ATOM     10  O4    U     1      46.444  32.975  46.256  1.00  0.00


ATOM      1  O5'   U X   1      42.778  25.208  46.287  1.00  0.00
ATOM      2  C5'   U X   1      42.780  26.630  45.876  1.00  0.00
ATOM      3  C4'   U X   1      42.080  27.526  46.956  1.00  0.00
ATOM      4  O4'   U X   1      43.013  28.044  47.963  1.00  0.00
ATOM      5  C1'   U X   1      42.706  29.395  48.257  1.00  0.00
ATOM      6  N1    U X   1      43.857  30.305  47.703  1.00  0.00
ATOM      7  C6    U X   1      45.057  29.857  47.308  1.00  0.00
ATOM      8  C5    U X   1      46.025  30.676  46.763  1.00  0.00
ATOM      9  C4    U X   1      45.720  32.110  46.702  1.00  0.00
ATOM     10  O4    U X   1      46.444  32.975  46.256  1.00  0.00
usage: rna_add_chain [-h] [-c CHAIN] file
Positional arguments:
file file
-c, --chain a new chain, e.g. A

Measure distance between atoms

This is a quick and dirty method of comparison two RNA structures (stored in pdb files). It measures the distance between the relevan atoms (C4’) for nucleotides defined as “x” in the sequence alignment.

author: F. Stefaniak, modified by A. Zyla, supervision of mmagnus

usage: pdbs_measure_atom_dists [-h] [-v] seqid1 seqid2 alignfn pdbfn1 pdbfn2
Positional arguments:
seqid1 seq1 id in the alignemnt
seqid2 seq2 id in the alignemnt
alignfn alignemnt in the Fasta format
pdbfn1 pdb file1
pdbfn2 pdb file2
-v=False, --verbose=False
 increase output verbosity

This is a quick and dirty method of comparison two RNA structures (stored in pdb files). It measures the distance between the relevan atoms (C4’) for nucleotides defined as “x” in the sequence alignment.

author: F. Stefaniak, modified by A. Zyla, supervision of mmagnus

rna_tools.tools.pdbs_measure_atom_dists.pdbs_measure_atom_dists.find_core(seq_with_gaps1, seq_with_gaps2)[source]


  • seq_with_gaps1 (str) – a sequence 1 from the alignment
  • seq_with_gaps1 – a sequence 2 from the alignment


>>> find_core('GUUCAG-------------------UGAC-', 'CUUCGCAGCCAUUGCACUCCGGCUGCGAUG')
rna_tools.tools.pdbs_measure_atom_dists.pdbs_measure_atom_dists.get_seq(alignfn, seqid)[source]

Get seq from an alignment with gaps.

  • alignfn (str) – a path to an alignment
  • seqid (str) – seq id in an alignment


>>> get_seq('test_data/ALN_OBJ1_OBJ2.fa', 'obj1')
SeqRecord(seq=SeqRecord(seq=Seq('GUUCAG-------------------UGAC-', SingleLetterAlphabet()), id='obj1', name='obj1', description='obj1', dbxrefs=[]), id='<unknown id>', name='<unknown name>', description='<unknown description>', dbxrefs=[])


Args: structure (pdb): PDB Biopython object: with a pdb structure

Returns:a list of coords for atoms structure1realNumber: a list of residues
Return type:struct1dict

Open pdb with Biopython.

Parameters:pdbfn1 (str) – a path to a pdb structure
Returns:with a pdb structure
Return type:PDB Biopython object