rna-pdb-tools

rna_pdb_tools - a swiss army knife to manipulation of RNA pdb structures

Remove atoms with XYZ equals 0:

(base) ➜  MiniRoseTTA git:(main) ✗ cat  4GXY_min_at0_chemicals.pdb
ATOM      1  OP1   G A   1      50.150  76.113  39.198  1.00  0.00
ATOM      2  P     G A   1      50.001  77.254  40.137  1.00  0.00
ATOM      3  OP2   G A   1      48.880  77.258  41.111  1.00  0.00
ATOM      4  O5'   G A   1      51.362  77.417  40.948  1.00  0.00
ATOM      5  C5'   G A   1       0.000   0.000   0.000  1.00  0.00
ATOM      6  C4'   G A   1       0.000   0.000   0.000  1.00  0.00
ATOM      7  O4'   G A   1       0.000   0.000   0.000  1.00  0.00
ATOM      8  C3'   G A   1       0.000   0.000   0.000  1.00  0.00

to get:

(base) ➜  MiniRoseTTA git:(main) ✗ rna_pdb_tools.py --remove0  4GXY_min_at0_chemicals.pdb
ATOM      1  OP1   G A   1      50.150  76.113  39.198  1.00  0.00
ATOM      2  P     G A   1      50.001  77.254  40.137  1.00  0.00
ATOM      3  OP2   G A   1      48.880  77.258  41.111  1.00  0.00
ATOM      4  O5'   G A   1      51.362  77.417  40.948  1.00  0.00
ATOM     35  OP1   C A   2      54.648  73.216  44.394  1.00  0.00
ATOM     36  P     C A   2      53.712  74.058  43.607  1.00  0.00
ATOM     37  OP2   C A   2      53.842  74.111  42.128  1.00  0.00
ATOM     38  O5'   C A   2      52.223  73.613  43.957  1.00  0.00

rna_pdb_tools

rna_pdb_tools.py

rna_pdb_tools - a swiss army knife to manipulation of RNA pdb structures

Usage:

$ rna_pdb_tools.py --delete A:46-56 --inplace *.pdb

 $ rna_pdb_tools.py --get-seq *
 # BujnickiLab_RNApuzzle14_n01bound
 > A:1-61
 # BujnickiLab_RNApuzzle14_n02bound
 > A:1-61
 CGUUAGCCCAGGAAACUGGGCGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAGCAACGCG
 [...]

See rna_pdb_merge_into_one.py to merge PDB files in the order as you like into one NMR-like (multimodel) file

Examples:

rna_pdb_tools.py --backbone-only   --get-rnapuzzle-ready  --inplace --suffix=bo examples/4GXY_min.pdb

To extract specific atoms for each residue and write them to separate PDB file (next to the input files, following syntax “<input>_<resid>.pdb”):

rna_pdb_tools.py --rpr input/4GXY_min.pdb --save-single-res --ref-frame-only

Atoms presets:

--backbone-only       used only with --get-rnapuzzle-ready, keep only backbone (= remove bases)
--ref-frame-only      used only with --get-rnapuzzle-ready, keep only reference frames, OP1 OP2 P
--no-backbone         used only with --get-rnapuzzle-ready, remove atoms of backbone (define as P OP1 OP2 O5')
--bases-only          used only with --get-rnapuzzle-ready, keep only atoms of bases
_images/276411138-236435ff-2944-4bec-ab75-dca0d1e3aacf.jpg

-v is for verbose, –version for version ;)

usage: rna_pdb_tools.py [-h] [--version] [-r] [--no-progress-bar]
                        [--renum-atoms] [--renum-nmr] [--conect]
                        [--conect-no-linkage] [--renum-residues-dirty]
                        [--undo] [--delete-anisou] [--remove0] [--fix]
                        [--to-mol2] [--split-alt-locations] [-c] [--is-pdb]
                        [--is-nmr] [--nmr-dir NMR_DIR] [--un-nmr] [--orgmode]
                        [--get-chain GET_CHAIN] [--fetch] [--fetch-cif]
                        [--fetch-header] [--fetch-ba] [--fetch-chain]
                        [--fetch-fasta] [--get-seq] [--rgyration]
                        [--color-seq] [--ignore-files IGNORE_FILES]
                        [--compact] [--hide-warnings] [--get-ss]
                        [--rosetta2generic] [--no-hr] [--renumber-residues]
                        [--dont-rename-chains] [--dont-fix-missing-atoms]
                        [--inspect] [--collapsed-view] [--cv] [-v]
                        [--mutate MUTATE] [--edit EDIT]
                        [--rename-chain RENAME_CHAIN]
                        [--swap-chains SWAP_CHAINS] [--set-chain SET_CHAIN]
                        [--replace-chain REPLACE_CHAIN] [--delete DELETE]
                        [--extract EXTRACT] [--extract-chain EXTRACT_CHAIN]
                        [--uniq UNIQ] [--chain-first] [--oneline]
                        [--replace-htm] [--fasta] [--cif2pdb] [--pdb2cif]
                        [--mdr] [--get-rnapuzzle-ready] [--rpr]
                        [--keep-hetatm] [--inplace] [--here] [--suffix SUFFIX]
                        [--replace-hetatm] [--dont-report-missing-atoms]
                        [--backbone-only] [--p-only] [--ref-frame-only]
                        [--no-backbone] [--bases-only] [--save-single-res]
                        file [file ...]
file

file

-h, --help

show this help message and exit

--version
-r, --report

get report

--no-progress-bar

for –no-progress-bar for –rpr

--renum-atoms

renumber atoms, tested with –get-seq

--renum-nmr
--conect

add conect to rpr file

--conect-no-linkage

dont add conect from our residue to another

--renum-residues-dirty
--undo

undo operation of action done –inplace, , rename “backup files” .pdb~ to pdb, ALL files in the folder, not only ~ related to the last action (that you might want to revert, so be careful)

--delete-anisou

remove files with ANISOU records, works with –inplace

--remove0

remove atoms of X=0 position

--fix

fix a PDB file, ! external program, pdbfixer used to fix missing atoms

--to-mol2

fix a PDB file, ! external program, pdbfixer used to fix missing atoms

--split-alt-locations

splits atoms, e.g. for alt locs A and B, it splits atoms two MODELS (all localizations A goes into MODEL1 and all localizations B goes into MODEL2

-c, --clean

get clean structure

--is-pdb

check if a file is in the pdb format

--is-nmr

check if a file is NMR-style multiple model pdb

--nmr-dir <nmr_dir>

make NMR-style multiple model pdb file from a set of files rna_pdb_tools.py –nmr-dir . ‘cwc15_u5_fragments*.pdb’ > ~/Desktop/cwc15-u5.pdb please use ‘’ for pattern file recognition, this is a hack to deal with folders with thousands of models, if you used only *.pdb then the terminal will complain that you selected to many files.

--un-nmr

split NMR-style multiple model pdb files into individual models [biopython], rna_pdb_tools.py –un-nmr split.pdb 2 /Users/magnus/Desktop/3hl2/split_1.pdb /Users/magnus/Desktop/3hl2/split_2.pdb

--orgmode

get a structure in org-mode format <sick!>

--get-chain <get_chain>

get chain, one or many, e.g, A, but now also ABC works

--fetch

fetch file from the PDB db, e.g., 1xjr, use ‘rp’ to fetch, fetch a given join, 4w90:C or 4w90_Cthe RNA-Puzzles standardized_dataset [around 100 MB]

--fetch-cif
--fetch-header
--fetch-ba

fetch biological assembly from the PDB db

--fetch-chain

fetch a structure in extract chain, e.g. 6bk8 H

--fetch-fasta

fetch a fasta/sequence for given PDB ID, e.g. 6bk8

--get-seq

get seq

--rgyration

get seq

--color-seq

color seq, works with –get-seq

--ignore-files <ignore_files>

files to be ingored, .e.g, ‘solution’

--compact

with –get-seq, get it in compact view’ $ rna_pdb_tools.py –get-seq –compact *.pdb # 20_Bujnicki_1 ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68 # 20_Bujnicki_2 ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68 # 20_Bujnicki_3 ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68 # 20_Bujnicki_4

--hide-warnings

hide warnings, works with –get-chain, it hides warnings that given changes are not detected in a PDB file

--get-ss

get secondary structure

--rosetta2generic

convert ROSETTA-like format to a generic pdb

--no-hr

do not insert the header into files

--renumber-residues

by defult is false

--dont-rename-chains

used only with –get-rnapuzzle-ready. By default: –get-rnapuzzle-ready rename chains from ABC.. to stop behavior switch on this option

--dont-fix-missing-atoms

used only with –get-rnapuzzle-ready

--inspect

inspect missing atoms (technically decorator to –get-rnapuzzle-ready without actually doing anything but giving a report on problems)

--collapsed-view
--cv

alias to collapsed_view

-v, --verbose

tell me more what you’re doing, please!

--mutate <mutate>

mutate residues, e.g., –mutate “A:1a+2a+3a+4a,B:1a” to mutate to adenines the first four nucleotides of the chain A and the first nucleotide of the chain B

--edit <edit>

edit ‘A:6>B:200’, ‘A:2-7>B:2-7’

--rename-chain <rename_chain>

edit ‘A>B’ to rename chain A to chain B

--swap-chains <swap_chains>

B>A, rename A to _, then B to A, then _ to B

--set-chain <set_chain>

set chain for all ATOM lines and TER (quite brutal function)

--replace-chain <replace_chain>

a file PDB name with one chain that will be used to replace the chain in the original PDB file, the chain id in this file has to be the same with the chain id of the original chain

--delete <delete>

delete the selected fragment, e.g. A:10-16, or for more than one fragment –delete ‘A:1-25+30-57’

--extract <extract>

extract the selected fragment, e.g. A:10-16, or for more than one fragment –extract ‘A:1-25+30-57’, or even ‘A:1-25+B:30-57’

--extract-chain <extract_chain>

extract chain, e.g. A

--uniq <uniq>

rna_pdb_tools.py –get-seq –uniq ‘[:5]’ –compact –chain-first * | sort A:1-121 ACCUUGCGCAACUGGCGAAUCCUGGGGCUGCCGCCGGCAGUACCC…CA # rp13nc3295_min.out.1 A:1-123 ACCUUGCGCGACUGGCGAAUCCUGAAGCUGCUUUGAGCGGCUUCG…AG # rp13cp0016_min.out.1 A:1-123 ACCUUGCGCGACUGGCGAAUCCUGAAGCUGCUUUGAGCGGCUUCG…AG # zcp_6537608a_ALL-000001_AA A:1-45 57-71 GGGUCGUGACUGGCGAACAGGUGGGAAACCACCGGGGAGCGACCCGCCGCCCGCCUGGGC # solution

--chain-first
--oneline
--replace-htm
--fasta

with –get-seq, show sequences in fasta format, can be combined with –compact (mind, chains will be separated with ‘ ‘ in one line) $ rna_pdb_tools.py –get-seq –fasta –compact input/20_Bujnicki_1.pdb > 20_Bujnicki_1 ACCCGCAAGGCCGACGGC GCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU

--cif2pdb

convert cif to PDB, fancy way

--pdb2cif

[PyMOL Python package required]

--mdr

get structures ready for MD (like rpr but without first)

--get-rnapuzzle-ready

get RNApuzzle ready (keep only standard atoms).’ Be default it does not renumber residues, use –renumber-residues [requires BioPython]

--rpr

alias to get_rnapuzzle ready)

--keep-hetatm

keep hetatoms

--inplace

in place edit the file! [experimental, only for get_rnapuzzle_ready, –delete, –get-ss, –get-seq, –edit-pdb]

--here

save a file next to the original file with auto suffix for –extract it’s .extr.pdb

--suffix <suffix>

when used with –inplace allows you to change a name of a new file, –suffix del will give <file>_del.pdb (mind added _)

--replace-hetatm

replace ‘HETATM’ with ‘ATOM’ [tested only with –get-rnapuzzle-ready]

--dont-report-missing-atoms

used only with –get-rnapuzzle-ready

--backbone-only

used only with –get-rnapuzzle-ready, keep only backbone (= remove bases)

--p-only

used only with –get-rnapuzzle-ready, keep p backbone (= remove bases)

--ref-frame-only

used only with –get-rnapuzzle-ready, keep only reference frames, OP1 OP2 P

--no-backbone

used only with –get-rnapuzzle-ready, remove atoms of backbone (define as P OP1 OP2 O5’)

--bases-only

used only with –get-rnapuzzle-ready, keep only atoms of bases

--save-single-res

used only with –get-rnapuzzle-ready, for each residue create a new pdb output file, you can combine it with –bases-only etc.

get RNAPuzzle ready

class rna_tools.rna_tools_lib.RNAStructure(fn='')[source]

RNAStructure - handles an RNA pdb file.

fn

path to the structural file, e.g., “../rna_tools/input/4ts2.pdb”

Type:

string

name

filename of the structural file, “4ts2.pdb”

Type:

string

lines

the PDB file is loaded and ATOM/HETATM/TER/END go to self.lines

Type:

list

get_rnapuzzle_ready(renumber_residues=True, fix_missing_atoms=True, rename_chains=True, ignore_op3=False, report_missing_atoms=True, keep_hetatm=False, backbone_only=False, no_backbone=False, bases_only=False, save_single_res=False, ref_frame_only=False, p_only=False, check_geometry=False, conect=False, conect_no_linkage=False, verbose=False)[source]

Get rnapuzzle (SimRNA) ready structure.

Clean up a structure, get current order of atoms.

Parameters:
  • renumber_residues – boolean, from 1 to …, second chain starts from 1 etc.

  • fix_missing_atoms – boolean, superimpose motifs from the minilibrary and copy-paste missing atoms, this is super crude, so should be used with caution.

Submission format @http://ahsoka.u-strasbg.fr/rnapuzzles/

Run rna_tools.rna_tools.lib.RNAStructure.std_resn() before this function to fix names.

_images/rebuild_op1op2_backbone.png

Figure: (Starting from left) input structure, structure with rebuilded atoms, and reference. The B fragment is observed in the reference used here as a “benchmark”, fragment A is reconstructed atoms (not observed in the reference”). 201122

  • 170305 Merged with get_simrna_ready and fixing OP3 terminal added

  • 170308 Fix missing atoms for bases, and O2’

_images/fix_missing_o_before_after.png

Fig. Add missing O2’ atom (before and after).

_images/fix_missing_superposition.png

Fig. The residue to fix is in cyan. The G base from the library in red. Atoms O4’, C2’, C1’ are shared between the sugar (in cyan) and the G base from the library (in red). These atoms are used to superimpose the G base on the sugar, and then all atoms from the base are copied to the residues.

_images/fix_missing_bases.png

Fig. Rebuild ACGU base-less. It’s not perfect but good enough for some applications.

Warning

It was only tested with the whole base missing!

Warning

requires: Biopython

Selection of atoms:

  • posphate group (3x, OP1 ,P, OP2),

  • connector (2x O5’, C5’), /5x

  • sugar (5x, C4’, O4’, C3’, O3’, C1’, C2’), /10

  • extra oxygens from sugar (2x, O2’ O3’), for now it’s /12!

  • A (10x), G (11x), C (8x), U(8x), max 12+11=23

And 27 unique atoms: {‘N9’, ‘O2’, ‘OP2’, “O2’”, “O4’”, ‘C8’, “O3’”, “C1’”, ‘C2’, ‘C6’, “C5’”, ‘N6’, ‘C5’, “C4’”, ‘C4’, “O5’”, “C3’”, ‘O6’, ‘N2’, ‘N7’, ‘OP1’, ‘N1’, ‘N4’, ‘P’, “C2’”, ‘N3’, ‘O4’}.

get sequence

Example:

$ rna_pdb_tools.py --get-seq 5_solution_1.pdb
> 5_solution_1.pdb A:1-576
CAUCCGGUAUCCCAAGACAAUCUCGGGUUGGGUUGGGAAGUAUCAUGGCUAAUCACCAUGAUGCAAUCGGGUUGAACACUUAAUUGGGUUAAAACGGUGGGGGACGAUCCCGUAACAUCCGUCCUAACGGCGACAGACUGCACGGCCCUGCCUCAGGUGUGUCCAAUGAACAGUCGUUCCGAAAGGAAG
class rna_tools.rna_tools_lib.RNAStructure(fn='')[source]

RNAStructure - handles an RNA pdb file.

fn

path to the structural file, e.g., “../rna_tools/input/4ts2.pdb”

Type:

string

name

filename of the structural file, “4ts2.pdb”

Type:

string

lines

the PDB file is loaded and ATOM/HETATM/TER/END go to self.lines

Type:

list

get_seq(compact=False, chainfirst=False, fasta=False, addfn='', color=False)[source]

Get seq (v2) gets segments of chains with correct numbering

Run:

python rna_pdb_seq.py input/1ykq_clx.pdb
> 1ykq_clx A:101-111
GGAGCUCGCCC
> 1ykq_clx B:201-238
GGGCGAGGCCGUGCCAGCUCUUCGGAGCAAUACUCGGC

> 6_solution_0 A:1-19 26-113 117-172
GGCGGCAGGUGCUCCCGACGUCGGGAGUUAAAAGGGAAG

Chains is {'A': {'header': 'A:1-19 26-113 117-172', 'resi': [1, 2, 3, ...,         19, 26, 27, ..., 172], 'seq': ['G', 'G', 'C', 'G', ... C', 'G', 'U', 'C']}}

Chains are in other as the appear in the file.

Warning

take only ATOM and HETATM lines.

fetch

Example:

$ rna_pdb_tools.py --fetch 1xjr
downloading...1xjr ok
rna_tools.rna_tools_lib.fetch(pdb_id, path='.')[source]

fetch pdb file from RCSB.org https://files.rcsb.org/download/1Y26.pdb

Args: - pdb_id, but also a chain can be specified, 1jj2:A+B+C

Returns: - a path to a file

TODO: na_pdb_tools.py –extract A:1-25+B:30-57 1jj2.pdb

fetch Biological Assembly

Example:

$ rna_pdb_tools.py --fetch-ba 1xjr
downloading...1xjr_ba.pdb ok

or over a list of pdb ids in a text file:

$ cat data/pdb_ids.txt
1y26
1fir

$ while read p; do rna_pdb_tools.py --fetch-ba $p; done < data/pdb_ids.txt
downloading...1y26_ba.pdb ok
downloading...1fir_ba.pdb ok

$ ls *.pdb
1fir_ba.pdb 1y26_ba.pdb
rna_tools.rna_tools_lib.fetch_ba(pdb_id, path='.')[source]

fetch biological assembly pdb file from RCSB.org

>>> fetch_ba('1xjr')
...

delete

Examples:

$ for i in *pdb; do rna_pdb_tools.py --delete A:46-56 $i > ../rpr_rm_loop/$i ; done

go over all files in the current directory, remove a fragment of chain A, residues between 46-56 (including them) and save outputs to in the folder rpr_rm_loops.

edit

rna_tools.rna_tools_lib.edit_pdb(f, args)[source]

Edit your structure.

The function can take A:3-21>A:1-19 or even syntax like this A:3-21>A:1-19,B:22-32>B:20-30 and will do an editing.

The output is printed, line by line. Only ATOM lines are edited!

Examples:

$ rna_pdb_tools.py --edit 'A:3-21>A:1-19' 1f27_clean.pdb > 1f27_clean_A1-19.pdb

or even:

$ rna_pdb_tools.py --edit 'A:3-21>A:1-19,B:22-32>B:20-30' 1f27_clean.pdb > 1f27_clean_renumb.pdb

RNAStructure (rna_tools_lib)

rna_tools_lib.py - main lib file, many tools in this lib is using this file.

exception rna_tools.rna_tools_lib.MethodUnknown[source]
exception rna_tools.rna_tools_lib.PDBFetchError[source]
class rna_tools.rna_tools_lib.RNAStructure(fn='')[source]

RNAStructure - handles an RNA pdb file.

fn

path to the structural file, e.g., “../rna_tools/input/4ts2.pdb”

Type:

string

name

filename of the structural file, “4ts2.pdb”

Type:

string

lines

the PDB file is loaded and ATOM/HETATM/TER/END go to self.lines

Type:

list

check_geometry(verbose=False)[source]

Check for correct “Polymer linkage, it should be around 1.6Å with a sigma around 0.01.

Carrascoza, F., Antczak, M., Miao, Z., Westhof, E. & Szachniuk, M. Evaluation of the stereochemical quality of predicted RNA 3D models in the RNA-Puzzles submissions. Rna 28, 250–262 (2022).

Values for 1xjr.pdb:

op.mean(): 1.599316
op.std(): 0.009274074

po.mean(): 1.5984017
po.std(): 0.0069191623

requires biopython

edit_occupancy_of_pdb(pdb, pdb_out, v=False)[source]

Make all atoms 1 (flexi) and then set occupancy 0 for seletected atoms. Return False if error. True if OK

fix_O_in_UC()[source]
fix_op_atoms()[source]

Replace OXP’ to OPX1, e.g (‘O1P’ -> ‘OP1’)

fix_with_qrnas(outfn='', verbose=False)[source]

Add missing heavy atom.

A residue is recognized base on a residue names.

Copy QRNAS folder to curr folder, run QRNAS and remove QRNAS.

Warning

QRNAS required (http://genesilico.pl/QRNAS/QRNAS.tgz)

get_all_chain_ids()[source]
Returns:

chain ids, e.g. set([‘A’, ‘B’])

Return type:

set

get_atom_code(line)[source]

Get atom code from a line of a PDB file

get_atom_coords(line)[source]

Get atom coordinates from a line of a PDB file

get_atom_num(line)[source]

Extract atom number from a line of PDB file :param * line = ATOM line from a PDB file:

Output:
  • atom number (int)

get_info_chains()[source]

return A:3-21 B:22-32

get_remarks_text()[source]

Get remarks as text for given file. This function re-open files, as define as self.fn to get remarks.

Example:

r = RNAStructure(fout)
remarks = r.get_remarks_txt()
r1 = r.get_res_txt('A', 1)
r2 = r.get_res_txt('A', 2)
r3 = r.get_res_txt('A', 3)
with open(fout, 'w') as f:
    f.write(remarks)
    f.write(r1)
    f.write(r2)
    f.write(r3)

remarks is

REMARK 250 Model edited with rna-tools
REMARK 250  ver 3.5.4+63.g4338516.dirty
REMARK 250  https://github.com/mmagnus/rna-tools
REMARK 250  Fri Nov 13 10:15:19 2020
get_report()[source]
Returns:

report, messages collected on the way of parsing this file

Return type:

string

get_res_code(line)[source]

Get residue code from a line of a PDB file

get_res_num(line)[source]

Extract residue number from a line of PDB file :param * line = ATOM line from a PDB file:

Output:
  • residue number as an integer

get_res_text(chain_id, resi)[source]

Get a residue of given resi of chain_id and return as a text

Parameters:
  • chain_id (str) – e.g., ‘A’

  • resi (int) – e.g., 1

Return type:

txt

Example:

r = RNAStructure(fn)
print(r.get_res_txt('A', 1))

ATOM      1  O5'   G A   1      78.080 -14.909  -0.104  1.00  9.24           O
ATOM      2  C5'   G A   1      79.070 -15.499  -0.956  1.00  9.70           C
ATOM      3  C4'   G A   1      78.597 -16.765  -1.648  1.00  9.64           C
ATOM      4  O4'   G A   1      78.180 -17.761  -0.672  1.00  9.88           O
(...)
get_rnapuzzle_ready(renumber_residues=True, fix_missing_atoms=True, rename_chains=True, ignore_op3=False, report_missing_atoms=True, keep_hetatm=False, backbone_only=False, no_backbone=False, bases_only=False, save_single_res=False, ref_frame_only=False, p_only=False, check_geometry=False, conect=False, conect_no_linkage=False, verbose=False)[source]

Get rnapuzzle (SimRNA) ready structure.

Clean up a structure, get current order of atoms.

Parameters:
  • renumber_residues – boolean, from 1 to …, second chain starts from 1 etc.

  • fix_missing_atoms – boolean, superimpose motifs from the minilibrary and copy-paste missing atoms, this is super crude, so should be used with caution.

Submission format @http://ahsoka.u-strasbg.fr/rnapuzzles/

Run rna_tools.rna_tools.lib.RNAStructure.std_resn() before this function to fix names.

_images/rebuild_op1op2_backbone.png

Figure: (Starting from left) input structure, structure with rebuilded atoms, and reference. The B fragment is observed in the reference used here as a “benchmark”, fragment A is reconstructed atoms (not observed in the reference”). 201122

  • 170305 Merged with get_simrna_ready and fixing OP3 terminal added

  • 170308 Fix missing atoms for bases, and O2’

_images/fix_missing_o_before_after.png

Fig. Add missing O2’ atom (before and after).

_images/fix_missing_superposition.png

Fig. The residue to fix is in cyan. The G base from the library in red. Atoms O4’, C2’, C1’ are shared between the sugar (in cyan) and the G base from the library (in red). These atoms are used to superimpose the G base on the sugar, and then all atoms from the base are copied to the residues.

_images/fix_missing_bases.png

Fig. Rebuild ACGU base-less. It’s not perfect but good enough for some applications.

Warning

It was only tested with the whole base missing!

Warning

requires: Biopython

Selection of atoms:

  • posphate group (3x, OP1 ,P, OP2),

  • connector (2x O5’, C5’), /5x

  • sugar (5x, C4’, O4’, C3’, O3’, C1’, C2’), /10

  • extra oxygens from sugar (2x, O2’ O3’), for now it’s /12!

  • A (10x), G (11x), C (8x), U(8x), max 12+11=23

And 27 unique atoms: {‘N9’, ‘O2’, ‘OP2’, “O2’”, “O4’”, ‘C8’, “O3’”, “C1’”, ‘C2’, ‘C6’, “C5’”, ‘N6’, ‘C5’, “C4’”, ‘C4’, “O5’”, “C3’”, ‘O6’, ‘N2’, ‘N7’, ‘OP1’, ‘N1’, ‘N4’, ‘P’, “C2’”, ‘N3’, ‘O4’}.

get_seq(compact=False, chainfirst=False, fasta=False, addfn='', color=False)[source]

Get seq (v2) gets segments of chains with correct numbering

Run:

python rna_pdb_seq.py input/1ykq_clx.pdb
> 1ykq_clx A:101-111
GGAGCUCGCCC
> 1ykq_clx B:201-238
GGGCGAGGCCGUGCCAGCUCUUCGGAGCAAUACUCGGC

> 6_solution_0 A:1-19 26-113 117-172
GGCGGCAGGUGCUCCCGACGUCGGGAGUUAAAAGGGAAG

Chains is {'A': {'header': 'A:1-19 26-113 117-172', 'resi': [1, 2, 3, ...,         19, 26, 27, ..., 172], 'seq': ['G', 'G', 'C', 'G', ... C', 'G', 'U', 'C']}}

Chains are in other as the appear in the file.

Warning

take only ATOM and HETATM lines.

get_text(add_end=True)[source]

works on self.lines.

is_amber_like()[source]

Use self.lines and check if there is XX line

is_mol2()[source]

Return True if is_mol2 based on the presence of `@<TRIPOS>`.

is_nmr()[source]

True if the file is an NMR-style multiple model pdb

Returns:

True or Fo

Return type:

boolean

is_pdb()[source]

Return True if the files is in PDB format.

If self.lines is empty it means that nothing was parsed into the PDB format.

reload()[source]

Reload the object.

remove(verbose)[source]

Delete file, self.fn

remove_ion()[source]

TER 1025 U A 47 HETATM 1026 MG MG A 101 42.664 34.395 50.249 1.00 70.99 MG HETATM 1027 MG MG A 201 47.865 33.919 48.090 1.00 67.09 MG

rtype:

object

remove_water()[source]

Remove HOH and TIP3

rename_chain(chain_id_old, chain_id_new, debug=False)[source]

Rename chains

Parameters:
  • chain_id_old (str) – e.g., A

  • chain_id_new (str) – e.g., B

  • debug (bool) – show some diagnostics

Returns:

pdb content (txt) self.lines is updated with new lines

renum_atoms()[source]

Renum atoms, from 1 to X for line; ATOM/HETATM

set_atom_code(line, code)[source]

Add atom name/code:

ATOM 1 OP2 C A 1 29.615 36.892 42.657 1.00 1.00 O

^^^ ^ and element

set_atom_coords(line, x, y, z)[source]

Get atom coordinates from a line of a PDB file

set_atom_occupancy(line, occupancy)[source]

set occupancy for line

set_occupancy_atoms(occupancy)[source]
Parameters:

occupancy

set_res_code(line, code)[source]
Parameters:
  • lines

  • code

path (str): The path of the file to wrap field_storage (FileStorage): The :class:Y instance to wrap

temporary (bool): Whether or not to delete the file when the File instance is destructed

Returns:

A buffered writable file descriptor

Return type:

BufferedFileStorage

std_resn()[source]

‘Fix’ residue names which means to change them to standard, e.g. RA5 -> A

Works on self.lines, and returns the result to self.lines.

Will change things like:

# URI -> U, URA -> U
1xjr_clx_charmm.pdb:ATOM    101  P   URA A   5      58.180  39.153  30.336  1.00 70.94
rp13_Dokholyan_1_URI_CYT_ADE_GUA_hydrogens.pdb:ATOM  82  P   URI A   4     501.633 506.561 506.256  1.00  0.00         P
un_nmr(startwith1=True, directory='', verbose=False)[source]

Un NMR - Split NMR-style multiple model pdb files into individual models.

Take self.fn and create new files in the way:

input/1a9l_NMR_1_2_models.pdb
   input/1a9l_NMR_1_2_models_0.pdb
   input/1a9l_NMR_1_2_models_1.pdb

Warning

This function requires biopython.

rna_pdb_tools.py –un-nmr AF-Q5TCX8-F1-model_v1_core_Ctrim_mdr_MD.pdb

36

cat MD_ > md.pdb

write(outfn='', verbose=False)[source]

Write `self.lines` to a file (and add END file)

Parameters:
  • outfn (str) – file to save, if outfn is ‘’, then simply use self.fn

  • verbose (Boolen) – be verbose or not

Returns:

None

rna_tools.rna_tools_lib.aa3to1(aaa)[source]

based on https://pymolwiki.org/index.php/Aa_codes

rna_tools.rna_tools_lib.collapsed_view(args)[source]

Collapsed view of pdb file. Only lines with C5’ atoms are shown and TER, MODEL, END.

example:

[mm] rna_tools git:(master) $ python rna-pdb-tools.py --cv input/1f27.pdb
ATOM      1  C5'   A A   3      25.674  19.091   3.459  1.00 16.99           C
ATOM     23  C5'   C A   4      19.700  19.206   5.034  1.00 12.65           C
ATOM     43  C5'   C A   5      14.537  16.130   6.444  1.00  8.74           C
ATOM     63  C5'   G A   6      11.726  11.579   9.544  1.00  9.81           C
ATOM     86  C5'   U A   7      12.007   7.281  13.726  1.00 11.35           C
ATOM    106  C5'   C A   8      12.087   6.601  18.999  1.00 12.74           C
TER
rna_tools.rna_tools_lib.edit_pdb(f, args)[source]

Edit your structure.

The function can take A:3-21>A:1-19 or even syntax like this A:3-21>A:1-19,B:22-32>B:20-30 and will do an editing.

The output is printed, line by line. Only ATOM lines are edited!

Examples:

$ rna_pdb_tools.py --edit 'A:3-21>A:1-19' 1f27_clean.pdb > 1f27_clean_A1-19.pdb

or even:

$ rna_pdb_tools.py --edit 'A:3-21>A:1-19,B:22-32>B:20-30' 1f27_clean.pdb > 1f27_clean_renumb.pdb
rna_tools.rna_tools_lib.fetch(pdb_id, path='.')[source]

fetch pdb file from RCSB.org https://files.rcsb.org/download/1Y26.pdb

Args: - pdb_id, but also a chain can be specified, 1jj2:A+B+C

Returns: - a path to a file

TODO: na_pdb_tools.py –extract A:1-25+B:30-57 1jj2.pdb

rna_tools.rna_tools_lib.fetch_ba(pdb_id, path='.')[source]

fetch biological assembly pdb file from RCSB.org

>>> fetch_ba('1xjr')
...
rna_tools.rna_tools_lib.fetch_cif(cif_id, path='.')[source]

fetch biological assembly cif file from RCSB.org

rna_tools.rna_tools_lib.fetch_cif_ba(cif_id, path='.')[source]

fetch biological assembly cif file from RCSB.org

rna_tools.rna_tools_lib.generate_conect_records(residue_type, shift=0, no_junction=True)[source]

Generate CONECT records for an RNA residue (U, A, C, or G).

Parameters:
  • residue_type (str) – Type of residue (‘U’, ‘A’, ‘C’, or ‘G’).

  • shift (int) – Value to shift all atom serial numbers by.

Returns:

List of CONECT records as strings.

Return type:

list

rna_tools.rna_tools_lib.get_rna_tools_path()[source]

Return path to the rt.

rna_tools.rna_tools_lib.load_rnas(path, verbose=True)[source]

Load structural files (via glob) and return a list of RNAStructure objects.

Examples:

rnas = rtl.load_rnas('../rna_tools/input/mq/*.pdb')
rna_tools.rna_tools_lib.replace_atoms(struc_fn, insert_fn, verbose=False)[source]

Replace XYZ coordinate of the file (struc_fn) with XYZ from another file (insert_fn).

This can be useful if you want to replace positions of atoms, for example, one base only. The lines are muted based on atom name, residue name, chain, residue index (marked with XXXX below).:

ATOM 11 N1 A 2 27 303.441 273.472 301.457 1.00 0.00 N # file ATOM 1 N1 A 2 27 300.402 273.627 303.188 1.00 99.99 N # insert ATOM 11 N1 A 2 27 300.402 273.627 303.188 1.00 0.00 N # inserted

XXXXXXXXXXXXXXXX # part used to find lines to be replaced

ATOM 1 P A 2 27 295.653 270.783 300.135 1.00119.29 P # next line

Parameters:
  • struc_fn (str) – path to the main PDB file

  • insert_fn (str) – path to the file that will be injected in into the main PDB file

Returns:

text in the PDB format

Return type:

string

rna_tools.rna_tools_lib.replace_chain(struc_fn, insert_fn, chain_id)[source]

Replace chain of the main file (struc_fn) with some new chain (insert_fn) of given chain id.

Parameters:
  • struc_fn (str) – path to the main PDB file

  • insert_fn (str) – path to the file that will be injected in into the main PDB file

  • chain_id (str) – chain that will be inserted into the main PDB file

Returns:

text in the PDB format

Return type:

string

rna_tools.rna_tools_lib.set_chain_for_struc(struc_fn, chain_id, save_file_inplace=False, skip_ter=True)[source]

Quick & dirty function to set open a fn PDB format, set chain_id and save it to a file. Takes only lines with ATOM and TER.

rna_tools.rna_tools_lib.sort_strings(l)[source]

Sort the given list in the way that humans expect. http://blog.codinghorror.com/sorting-for-humans-natural-sort-order/

Standardize your PDB files

rna_standardize.py

rna_standardize.py - standardzie RNA PDB structures

Usage:

$ rna_standardize.py <pdb file>

-v is for verbose, –version for version ;)

usage: rna_standardize.py [-h] [--version] [--no-progress-bar] [--quiet]
                          [--renum-nmr] [--inplace] [-v] [--conect]
                          [--conect-no-linkage] [--dont-replace-hetatm]
                          [--keep-hetatm] [--here] [--no-hr] [--cif]
                          [--check-geometry] [--dont-fix-missing-atoms]
                          [--mdr] [--renumber-residues] [--suffix SUFFIX]
                          [--dont-report-missing-atoms] [--dont-rename-chains]
                          [--backbone-only] [--no-backbone] [--bases-only]
                          file [file ...]
file

file

-h, --help

show this help message and exit

--version
--no-progress-bar

for –no-progress-bar for –rpr

--quiet

limit prints

--renum-nmr
--inplace

in place edit the file! [experimental, only for get_rnapuzzle_ready, –delete, –get-ss, –get-seq, –edit-pdb]

-v, --verbose

tell me more what you’re doing, please!

--conect

add conect to rpr file

--conect-no-linkage

dont add conect from our residue to another

--dont-replace-hetatm

replace ‘HETATM’ with ‘ATOM’ [tested only with –get-rnapuzzle-ready]

--keep-hetatm

keep hetatoms, [if not replaced anyway with ATOM, see –dont-replace-hetatm

--here

save a file next to the original file with auto suffix for –extract it’s .extr.pdb

--no-hr

do not insert the header into files

--cif

output as cif file

--check-geometry

check connectivity betweeen residues and angles

--dont-fix-missing-atoms

used only with –get-rnapuzzle-ready

--mdr

get structures ready for MD (like rpr but without first)

--renumber-residues

by defult is false

--suffix <suffix>

when used with –inplace allows you to change a name of a new file, –suffix del will give <file>_del.pdb (mind added _)

--dont-report-missing-atoms

used only with –get-rnapuzzle-ready

--dont-rename-chains

used only with –get-rnapuzzle-ready. By default: –get-rnapuzzle-ready rename chains from ABC.. to stop behavior switch on this option

--backbone-only

used only with –get-rnapuzzle-ready, keep only backbone (= remove bases)

--no-backbone

used only with –get-rnapuzzle-ready, remove atoms of backbone (define as P OP1 OP2 O5’)

--bases-only

used only with –get-rnapuzzle-ready, keep only atoms of bases

class rna_tools.rna_tools_lib.RNAStructure(fn='')[source]

RNAStructure - handles an RNA pdb file.

fn

path to the structural file, e.g., “../rna_tools/input/4ts2.pdb”

Type:

string

name

filename of the structural file, “4ts2.pdb”

Type:

string

lines

the PDB file is loaded and ATOM/HETATM/TER/END go to self.lines

Type:

list

get_rnapuzzle_ready(renumber_residues=True, fix_missing_atoms=True, rename_chains=True, ignore_op3=False, report_missing_atoms=True, keep_hetatm=False, backbone_only=False, no_backbone=False, bases_only=False, save_single_res=False, ref_frame_only=False, p_only=False, check_geometry=False, conect=False, conect_no_linkage=False, verbose=False)[source]

Get rnapuzzle (SimRNA) ready structure.

Clean up a structure, get current order of atoms.

Parameters:
  • renumber_residues – boolean, from 1 to …, second chain starts from 1 etc.

  • fix_missing_atoms – boolean, superimpose motifs from the minilibrary and copy-paste missing atoms, this is super crude, so should be used with caution.

Submission format @http://ahsoka.u-strasbg.fr/rnapuzzles/

Run rna_tools.rna_tools.lib.RNAStructure.std_resn() before this function to fix names.

_images/rebuild_op1op2_backbone.png

Figure: (Starting from left) input structure, structure with rebuilded atoms, and reference. The B fragment is observed in the reference used here as a “benchmark”, fragment A is reconstructed atoms (not observed in the reference”). 201122

  • 170305 Merged with get_simrna_ready and fixing OP3 terminal added

  • 170308 Fix missing atoms for bases, and O2’

_images/fix_missing_o_before_after.png

Fig. Add missing O2’ atom (before and after).

_images/fix_missing_superposition.png

Fig. The residue to fix is in cyan. The G base from the library in red. Atoms O4’, C2’, C1’ are shared between the sugar (in cyan) and the G base from the library (in red). These atoms are used to superimpose the G base on the sugar, and then all atoms from the base are copied to the residues.

_images/fix_missing_bases.png

Fig. Rebuild ACGU base-less. It’s not perfect but good enough for some applications.

Warning

It was only tested with the whole base missing!

Warning

requires: Biopython

Selection of atoms:

  • posphate group (3x, OP1 ,P, OP2),

  • connector (2x O5’, C5’), /5x

  • sugar (5x, C4’, O4’, C3’, O3’, C1’, C2’), /10

  • extra oxygens from sugar (2x, O2’ O3’), for now it’s /12!

  • A (10x), G (11x), C (8x), U(8x), max 12+11=23

And 27 unique atoms: {‘N9’, ‘O2’, ‘OP2’, “O2’”, “O4’”, ‘C8’, “O3’”, “C1’”, ‘C2’, ‘C6’, “C5’”, ‘N6’, ‘C5’, “C4’”, ‘C4’, “O5’”, “C3’”, ‘O6’, ‘N2’, ‘N7’, ‘OP1’, ‘N1’, ‘N4’, ‘P’, “C2’”, ‘N3’, ‘O4’}.

Atoms order

Atoms order, A as an example:

ATOM      1  P     G A   1      50.626  49.730  50.573  1.00100.19           P
ATOM      2  OP1   G A   1      49.854  48.893  49.562  1.00100.19           O
ATOM      3  OP2   G A   1      52.137  49.542  50.511  1.00 99.21           O
ATOM      4  O5'   G A   1      50.161  49.136  52.023  1.00 99.82           O
ATOM      5  C5'   G A   1      50.216  49.948  53.210  1.00 98.63           C
ATOM      6  C4'   G A   1      50.968  49.231  54.309  1.00 97.84           C
ATOM      7  O4'   G A   1      50.450  47.888  54.472  1.00 97.10           O
ATOM      8  C3'   G A   1      52.454  49.030  54.074  1.00 98.07           C
ATOM      9  O3'   G A   1      53.203  50.177  54.425  1.00 99.39           O
ATOM     10  C2'   G A   1      52.781  47.831  54.957  1.00 96.96           C
ATOM     11  O2'   G A   1      53.018  48.156  56.313  1.00 96.77           O
ATOM     12  C1'   G A   1      51.502  47.007  54.836  1.00 95.70           C
ATOM     13  N9    G A   1      51.628  45.992  53.798  1.00 93.67           N
ATOM     14  C8    G A   1      51.064  46.007  52.547  1.00 92.60           C
ATOM     15  N7    G A   1      51.379  44.966  51.831  1.00 91.19           N
ATOM     16  C5    G A   1      52.197  44.218  52.658  1.00 91.47           C
ATOM     17  C6    G A   1      52.848  42.992  52.425  1.00 90.68           C
ATOM     18  O6    G A   1      52.826  42.291  51.404  1.00 90.38           O
ATOM     19  N1    G A   1      53.588  42.588  53.534  1.00 90.71           N
ATOM     20  C2    G A   1      53.685  43.282  54.716  1.00 91.21           C
ATOM     21  N2    G A   1      54.452  42.733  55.671  1.00 91.23           N
ATOM     22  N3    G A   1      53.077  44.429  54.946  1.00 91.92           N
ATOM     23  C4    G A   1      52.356  44.836  53.879  1.00 92.62           C

ATOM     24  P     C A   2      54.635  50.420  53.741  1.00100.19           P
ATOM     25  OP1   C A   2      55.145  51.726  54.238  1.00100.19           O

OP3

The first residue will have only OP1 and OP2 (OP3 will be removed):

ATOM      1  OP3   G A   1      50.193  51.190  50.534  1.00 99.85           O
ATOM      2  P     G A   1      50.626  49.730  50.573  1.00100.19           P
ATOM      3  OP1   G A   1      49.854  48.893  49.562  1.00100.19           O
ATOM      4  OP2   G A   1      52.137  49.542  50.511  1.00 99.21           O
ATOM      5  O5'   G A   1      50.161  49.136  52.023  1.00 99.82           O
ATOM      6  C5'   G A   1      50.216  49.948  53.210  1.00 98.63           C
ATOM      7  C4'   G A   1      50.968  49.231  54.309  1.00 97.84           C

Listing. An example: 1ehz.pdb.

_images/op3.jpg

Torsion angle analysis

_images/torsions.jpg

rna_torsions.py

Examples:

$ rna_torsions.py ./input/4GXY_min.pdb
f, alphaprime, beta
input ./input/4GXY_min.pdb <Residue G het=  resseq=2 icode= >, -64.20924484900823, -143.18546007904766
input ./input/4GXY_min.pdb <Residue C het=  resseq=3 icode= >, 2.3394112025736815, 70.4052871669199

Comparison:

$ rna_x3dna.py input/4GXY_min.pdb -s
input: input/4GXY_min.pdb
   nt id   res  alpha   beta  gamma  delta  epsilon  zeta      e-z           chi     phase-angle sugar-type  ssZp    Dp  splay     paired
0   1  G  A.G2    NaN -143.2  153.7   82.5    -92.3 -31.9  -60(..)  -179.0(anti)  19.5(C3'-endo)  ~C3'-endo  4.39  4.56  18.32  no paired
1   2  C  A.C3 -111.4   70.4  160.0   80.6      NaN   NaN      NaN  -177.6(anti)  11.1(C3'-endo)  ~C3'-endo   NaN   NaN    NaN  no paired
usage: rna_torsions.py [-h] [-v] file
file
-h, --help

show this help message and exit

-v, --verbose

be verbose

PDB Edit Bfactor/Occupancy

rna_pdb_edit_occupancy_bfactor.py

rna_pdb_edit_occupancy_bfactor.py - edit occupancy or bfactor in PDB file.

Example:

rna_pdb_edit_occupancy_bfactor.py --occupancy --select A:1-40,B:1-22 \
                                 --set-to 0 \
                                 19_Bujnicki_Human_4_rpr_n0-000001.pdb


rna_pdb_edit_occupancy_bfactor.py --occupancy \
                                  --select A:1-2 \
                                  --select-atoms P+C4\' \
                                  --set-to 10 \
                                  -o test_data/3w3s_homologymodel_out.PD
                                  --set-not-selected-to 8
                                  test_data/3w3s_homologymodel.pdb
usage: rna_pdb_edit_occupancy_bfactor.py [-h] (--bfactor | --occupancy)
                                         [--select SELECT] [--set-to SET_TO]
                                         [--set-not-selected-to SET_NOT_SELECTED_TO]
                                         [-o OUTPUT] [--verbose]
                                         [--select-atoms SELECT_ATOMS]
                                         file
file

file

-h, --help

show this help message and exit

--bfactor

set bfactor

--occupancy

set occupancy

--select <select>

get chain, e.g A:1-10, works also for multiple chainse.g A:1-40,B:1-22

--set-to <set_to>

set value to, default is 1

--set-not-selected-to <set_not_selected_to>

set value to, default is 0

-o <output>, --output <output>

file output

--verbose

be verbose

--select-atoms <select_atoms>

select only given atomscan be only one atom, e.g. Por more, use ' for prims, e.g. P+C4'

rna_tools.tools.rna_pdb_edit_occupancy_bfactor.rna_pdb_edit_occupancy_bfactor.edit_occupancy_of_pdb(txt, pdb, pdb_out, bfactor, occupancy, set_to, set_not_selected_to, select_atoms, v=False)[source]

Change ouccupancy or bfactor of pdb file.

Load the structure, and first set everything to be set_not_selected_to and then set selected to sel_to.

Parameters:
  • txt (str) – A:1-10, selection, what to change

  • pdb (str) – filename to read as an input

  • pdb_out (str) – filename to save an output

  • bfactor (bool) – if edit bfactor

  • occupancy (bool) – if edit occupancy

  • set_to (float) – set to this value, if within selection

  • set_not_selected_to (float) – set to this value, if not within selection

  • select_atoms (str) – P, P+C4', use + as a separator

  • v (bool) – be verbose

Returns:

if OK, save an output to pdb_out

Return type:

bool

Warning

this function requires BioPython

Add chain to a file

Example:

./rna_add_chain.py -c X ../../input/1msy_rnakbmd_decoy999_clx_noChain.pdb     > ../../output/1msy_rnakbmd_decoy999_clx_noChain_Xchain.pdb

From:

ATOM      1  O5'   U     1      42.778  25.208  46.287  1.00  0.00
ATOM      2  C5'   U     1      42.780  26.630  45.876  1.00  0.00
ATOM      3  C4'   U     1      42.080  27.526  46.956  1.00  0.00
ATOM      4  O4'   U     1      43.013  28.044  47.963  1.00  0.00
ATOM      5  C1'   U     1      42.706  29.395  48.257  1.00  0.00
ATOM      6  N1    U     1      43.857  30.305  47.703  1.00  0.00
ATOM      7  C6    U     1      45.057  29.857  47.308  1.00  0.00
ATOM      8  C5    U     1      46.025  30.676  46.763  1.00  0.00
ATOM      9  C4    U     1      45.720  32.110  46.702  1.00  0.00
ATOM     10  O4    U     1      46.444  32.975  46.256  1.00  0.00

to:

ATOM      1  O5'   U X   1      42.778  25.208  46.287  1.00  0.00
ATOM      2  C5'   U X   1      42.780  26.630  45.876  1.00  0.00
ATOM      3  C4'   U X   1      42.080  27.526  46.956  1.00  0.00
ATOM      4  O4'   U X   1      43.013  28.044  47.963  1.00  0.00
ATOM      5  C1'   U X   1      42.706  29.395  48.257  1.00  0.00
ATOM      6  N1    U X   1      43.857  30.305  47.703  1.00  0.00
ATOM      7  C6    U X   1      45.057  29.857  47.308  1.00  0.00
ATOM      8  C5    U X   1      46.025  30.676  46.763  1.00  0.00
ATOM      9  C4    U X   1      45.720  32.110  46.702  1.00  0.00
ATOM     10  O4    U X   1      46.444  32.975  46.256  1.00  0.00

in a loop:

for i in *; do rna_add_chain.py -c A $i > ../struc/${i}; done
rna_tools.tools.misc.rna_add_chain.get_parser()[source]

rna_add_chain.py

usage: rna_add_chain.py [-h] [-c CHAIN] file
file

file

-h, --help

show this help message and exit

-c <chain>, --chain <chain>

a new chain, e.g. A

Measure distance between atoms

pdbs_measure_atom_dists.py

This is a quick and dirty method of comparison two RNA structures (stored in pdb files). It measures the distance between the relevan atoms (C4’) for nucleotides defined as “x” in the sequence alignment.

author: F. Stefaniak, modified by A. Zyla, supervision of mmagnus

usage: pdbs_measure_atom_dists.py [-h] [-v]
                                  seqid1 seqid2 alignfn pdbfn1 pdbfn2
seqid1

seq1 id in the alignemnt

seqid2

seq2 id in the alignemnt

alignfn

alignemnt in the Fasta format

pdbfn1

pdb file1

pdbfn2

pdb file2

-h, --help

show this help message and exit

-v, --verbose

increase output verbosity

This is a quick and dirty method of comparison two RNA structures (stored in pdb files). It measures the distance between the relevan atoms (C4’) for nucleotides defined as “x” in the sequence alignment.

author: F. Stefaniak, modified by A. Zyla, supervision of mmagnus

rna_tools.tools.pdbs_measure_atom_dists.pdbs_measure_atom_dists.find_core(seq_with_gaps1, seq_with_gaps2)[source]

.

Parameters:
  • seq_with_gaps1 (str) – a sequence 1 from the alignment

  • seq_with_gaps1 – a sequence 2 from the alignment

Usage:

>>> find_core('GUUCAG-------------------UGAC-', 'CUUCGCAGCCAUUGCACUCCGGCUGCGAUG')
'xxxxxx-------------------xxxx-'
Returns:

core=”xxxxxx——————-xxxx-”

rna_tools.tools.pdbs_measure_atom_dists.pdbs_measure_atom_dists.get_parser()[source]
rna_tools.tools.pdbs_measure_atom_dists.pdbs_measure_atom_dists.get_seq(alignfn, seqid)[source]

Get seq from an alignment with gaps.

Parameters:
  • alignfn (str) – a path to an alignment

  • seqid (str) – seq id in an alignment

Usage:

>>> get_seq('test_data/ALN_OBJ1_OBJ2.fa', 'obj1')
SeqRecord(seq=SeqRecord(seq=Seq('GUUCAG-------------------UGAC-', SingleLetterAlphabet()), id='obj1', name='obj1', description='obj1', dbxrefs=[]), id='<unknown id>', name='<unknown name>', description='<unknown description>', dbxrefs=[])
Returns:

SeqRecord

rna_tools.tools.pdbs_measure_atom_dists.pdbs_measure_atom_dists.map_coords_atom(structure)[source]

.

Args: structure (pdb): PDB Biopython object: with a pdb structure

Returns:

a list of coords for atoms structure1realNumber: a list of residues

Return type:

struct1dict

rna_tools.tools.pdbs_measure_atom_dists.pdbs_measure_atom_dists.open_pdb(pdbfn)[source]

Open pdb with Biopython.

Parameters:

pdbfn1 (str) – a path to a pdb structure

Returns:

with a pdb structure

Return type:

PDB Biopython object