Source code for rna_tools.rna_tools_lib

#!/usr/bin/env python3
# -*- coding: utf-8 -*-
"""rna_tools_lib.py - main lib file, many tools in this lib is using this file."""

import os
import sys
from collections import OrderedDict
import re
import string
import time
import gzip
import tempfile
import shutil
import subprocess

from rna_tools.tools.extra_functions.select_fragment import select_pdb_fragment_pymol_style, select_pdb_fragment

from icecream import ic
import sys
ic.configureOutput(outputFunction=lambda *a: print(*a, file=sys.stderr), includeContext=True)
ic.configureOutput(prefix='')

import logging
logger = logging.getLogger('rna-tools')
handler = logging.StreamHandler()
formatter = logging.Formatter('%(asctime)s - %(name)s - %(levelname)s - %(message)s')
handler.setFormatter(formatter)
logger.addHandler(handler)

# Don't fix OP3, ignore it
ignore_op3 = False

# Settings: what is what in a PDB file
AMINOACID_CODES = ["ALA", "ARG", "ASN", "ASP", "CYS", "GLU", "GLN", "GLY",
                   "HIS", "ILE", "LEU", "LYS", "MET", "PHE", "PRO", "SER", "THR",
                   "TRP", "TYR", "VAL"]

[docs] def generate_conect_records(residue_type, shift=0, no_junction=True): """ Generate CONECT records for an RNA residue (U, A, C, or G). Args: residue_type (str): Type of residue ('U', 'A', 'C', or 'G'). shift (int): Value to shift all atom serial numbers by. Returns: list: List of CONECT records as strings. """ # Define connections for each residue type if residue_type == "U": connections = [ (1, 2), # P -> OP1 (1, 3), # P -> OP2 (1, 4), # P -> O5' (4, 5), # O5' -> C5' (5, 6), # C5' -> C4' (6, 7), # C4' -> O4' (6, 8), # C4' -> C3' (8, 9), # C3' -> O3' (8, 10), # C3' -> C2' (10, 11), # C2' -> O2' (10, 12), # C2' -> C1' (12, 13), # C1' -> N1 (13, 14), # N1 -> C2 (14, 15), # C2 -> O2 (14, 16), # C2 -> N3 (16, 17), # N3 -> C4 (17, 18), # C4 -> O4 (17, 19), # C4 -> C5 (19, 20), # C5 -> C6 (20, 13), # C6 -> N1 (7, 12), # O4' -> C1' ] if not no_junction: connections.append((9, 21)) print(connections) elif residue_type == "A": connections = [ (1, 2), # P -> OP1 (1, 3), # P -> OP2 (1, 4), # P -> O5' (4, 5), # O5' -> C5' (5, 6), # C5' -> C4' (6, 7), # C4' -> O4' (6, 8), # C4' -> C3' (8, 9), # C3' -> O3' (8, 10), # C3' -> C2' (10, 11), # C2' -> O2' (10, 12), # C2' -> C1' (12, 13), # C1' -> N9 (13, 14), # N9 -> C8 (14, 15), # C8 -> N7 (15, 16), # N7 -> C5 (16, 17), # C5 -> C6 (17, 18), # C6 -> N6 (17, 19), # C6 -> N1 (19, 20), # N1 -> C2 (20, 21), # C2 -> N3 (21, 22), # N3 -> C4 (22, 16), # C4 -> C5 (22, 13), # C4 -> N9 (7, 12), # O4' -> C1' ] if not no_junction: connections.append((9, 23)) elif residue_type == "C": connections = [ (1, 2), # P -> OP1 (1, 3), # P -> OP2 (1, 4), # P -> O5' (4, 5), # O5' -> C5' (5, 6), # C5' -> C4' (6, 7), # C4' -> O4' (6, 8), # C4' -> C3' (8, 9), # C3' -> O3' (8, 10), # C3' -> C2' (10, 11), # C2' -> O2' (10, 12), # C2' -> C1' (12, 13), # C1' -> N1 (13, 14), # N1 -> C2 (14, 15), # C2 -> O2 (14, 16), # C2 -> N3 (16, 17), # N3 -> C4 (17, 18), # C4 -> N4 (17, 19), # C4 -> C5 (19, 20), # C5 -> C6 (20, 13), # C6 -> N1 (7, 12), # O4' -> C1' (additional connection) ] if not no_junction: connections.append((9, 21)) elif residue_type == "G": connections = [ (1, 2), # P -> OP1 (1, 3), # P -> OP2 (1, 4), # P -> O5' (4, 5), # O5' -> C5' (5, 6), # C5' -> C4' (6, 7), # C4' -> O4' (6, 8), # C4' -> C3' (8, 9), # C3' -> O3' (8, 10), # C3' -> C2' (10, 11), # C2' -> O2' (10, 12), # C2' -> C1' (12, 13), # C1' -> N9 (13, 14), # N9 -> C8 (14, 15), # C8 -> N7 (15, 16), # N7 -> C5 (16, 17), # C5 -> C6 (17, 18), # C6 -> O6 (17, 19), # C6 -> N1 (19, 20), # N1 -> C2 (20, 21), # C2 -> N2 (20, 22), # C2 -> N3 (22, 23), # N3 -> C4 (23, 16), # C4 -> C5 (23, 13), # C4 -> N9 (7, 12), # O4' -> C1' (additional connection) ] if not no_junction: connections.append((9, 24)) else: raise ValueError("Invalid residue type. Choose 'U', 'A', 'C', or 'G'.") # Generate CONECT records with shifted serial numbers conect_records = [] for conn in connections: atom1_serial, atom2_serial = conn # Shift the serial numbers atom1_serial += shift atom2_serial += shift conect_records.append(f"CONECT{atom1_serial:>5}{atom2_serial:>5}") return conect_records
[docs] def aa3to1(aaa): """based on https://pymolwiki.org/index.php/Aa_codes""" if len(aaa) != 3: # aaa is 'G', like for RNA ;-) return '' # dont do it for rna test aaa one_letter ={'VAL':'V', 'ILE':'I', 'LEU':'L', 'GLU':'E', 'GLN':'Q', \ 'ASP':'D', 'ASN':'N', 'HIS':'H', 'TRP':'W', 'PHE':'F', 'TYR':'Y', \ 'ARG':'R', 'LYS':'K', 'SER':'S', 'THR':'T', 'MET':'M', 'ALA':'A', \ 'GLY':'G', 'PRO':'P', 'CYS':'C'} return one_letter[aaa]
RES = ['DA', 'DG', 'DT', 'DC'] RES += ['A', 'G', 'U', 'C'] RESS = ['A', 'C', 'G', 'U', 'ADE', 'CYT', 'GUA', 'URY', 'URI', 'U34', 'U31', 'C31', '4SU', 'H2U', 'QUO', 'G7M', '5MU', '5MC', 'PSU', '2MG', '1MG', '1MA', 'M2G', '5BU', 'FHU', 'FMU', 'IU', 'OMG', 'OMC', 'OMU', 'A2M', 'A23', 'CCC', 'I'] + ['RC', 'RU', 'RA', 'RG', 'RT'] DNA = ['DA', 'DG', 'DT', 'DC'] RNA = ['A', 'G', 'U', 'C'] IONS = ['NA', 'MG', 'MN', 'JOS'] # and ligands JOS HYDROGEN_NAMES = ["H", "H5'", "H5''", "H4'", "H3'", "H2'", "HO2'", "H1'", "H3", "H5", "H6", "H5T", "H41", "1H5'", "2H5'", "HO2'", "1H4", "2H4", "1H2", "2H2", "H1", "H8", "H2", "1H6", "2H6", "HO5'", "H21", "H22", "H61", "H62", "H42", "HO3'", "1H2'", "2HO'", "HO'2", "H2'1", "HO'2", "HO'2", "H2", "H2'1", "H1", "H2", "1H5*", "2H5*", "H4*", "H3*", "H1*", "1H2*", "2HO*", "1H2", "2H2", "1H4", "2H4", "1H6", "2H6", "H1", "H2", "H3", "H5", "H6", "H8", "H5'1", "H5'2", "H3T"]
[docs] class PDBFetchError(Exception): pass
[docs] class MethodUnknown(Exception): pass
try: from Bio.PDB import * except ImportError: print("Biopython is not detected. It is required for some functions.") import warnings warnings.filterwarnings('ignore', '.*Invalid or missing.*',) warnings.filterwarnings('ignore', '.*with given element *',) warnings.filterwarnings('ignore', '.*is discontinuous*',) warnings.filterwarnings('ignore', '.*Some atoms or residues may be missing in the data structure.*',) warnings.filterwarnings('ignore', '.*Ignoring unrecognized record.*',) import subprocess def exe(cmd): o = subprocess.Popen( cmd, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE) out = o.stdout.read().strip().decode() err = o.stderr.read().strip().decode() return out, err
[docs] def get_rna_tools_path(): """Return path to the rt.""" import inspect import rna_tools return os.path.dirname(inspect.getfile(rna_tools))
def get_version(currfn='', verbose=False): import rna_tools return rna_tools.__version__
[docs] def sort_strings(l): """ Sort the given list in the way that humans expect. http://blog.codinghorror.com/sorting-for-humans-natural-sort-order/ """ def convert(text): return int(text) if text.isdigit() else text def alphanum_key(key): return [convert(c) for c in re.split('([0-9]+)', key)] l.sort(key=alphanum_key) return l
[docs] class RNAStructure: """RNAStructure - handles an RNA pdb file. Attributes: fn (string) : path to the structural file, e.g., "../rna_tools/input/4ts2.pdb" name(string) : filename of the structural file, "4ts2.pdb" lines (list) : the PDB file is loaded and ATOM/HETATM/TER/END go to self.lines """ def __init__(self, fn=''): if not fn: # if empty tf = tempfile.NamedTemporaryFile(delete=False) fn = tf.name self.fn = os.path.abspath(fn) # ../rna_tools/input/4ts2.pdb # add name attribute with filename 4ts2.pdb self.name = self.fn.split(os.sep)[-1] # OS.path.splitext(self.fn)[0] self.report = [] self.report.append('The RNARNAStructure report: %s ' % self.fn) self.mol2_format = False self.lines = [] try: # lines = open(fn).read().strip().split('\n') # don't strip?, good or bed? lines = open(fn).read().split('\n') except UnicodeDecodeError: print("Can't open a binary file") self.lines = '' return self.has_many_models = False for l in lines: # multi-models pdb files if l.startswith('MODEL'): self.has_many_models = True if l.startswith('ENDMDL'): break if l.startswith('ATOM') or l.startswith('HETATM') or l.startswith('TER') or l.startswith('END'): self.lines.append(l) # don't strip .strip()) if l.startswith("@<TRIPOS>"): self.mol2_format = True self.report.append('This is mol2 format') self.res = self.get_resn_uniq()
[docs] def reload(self): """Reload the object.""" self.__init__(self.fn)
[docs] def is_pdb(self): """Return True if the files is in PDB format. If self.lines is empty it means that nothing was parsed into the PDB format.""" if len(self.lines): return True else: return False
[docs] def is_nmr(self): """True if the file is an NMR-style multiple model pdb :returns: True or Fo :rtype: boolean """ return self.has_many_models
[docs] def un_nmr(self, startwith1=True, directory='', verbose=False): """Un NMR - Split NMR-style multiple model pdb files into individual models. Take self.fn and create new files in the way:: input/1a9l_NMR_1_2_models.pdb input/1a9l_NMR_1_2_models_0.pdb input/1a9l_NMR_1_2_models_1.pdb .. warning:: This function requires biopython. rna_pdb_tools.py --un-nmr AF-Q5TCX8-F1-model_v1_core_Ctrim_mdr_MD.pdb 36 cat *MD_* > md.pdb """ # npdb = '' c = 0 nmodels = 0 for l in open(self.fn): if l.startswith('MODEL'): nmodels += 1 print(nmodels) for l in open(self.fn): if 1: if not l.startswith('HETATM'): npdb += l if l.startswith('MODEL'): c += 1 if l.startswith('ENDMDL'): id = str(c).zfill(len(str(nmodels))) nf = self.fn.replace('.pdb', '_%s.pdb' % id) verbose = 1 if verbose: print(nf) with open(nf, 'w') as f: f.write(npdb) npdb = '' biopython = 0 if biopython: parser = PDBParser() structure = parser.get_structure('', self.fn) for c, m in enumerate(structure): if verbose: print(m) io = PDBIO() io.set_structure(m) if startwith1: c += 1 if directory: io.save(directory + os.sep + self.fn.replace('.pdb', '_%i.pdb' % c)) else: io.save(self.fn.replace('.pdb', '_%i.pdb' % c))
[docs] def is_mol2(self): """Return True if is_mol2 based on the presence of ```@<TRIPOS>```.""" return self.mol2_format
def decap_gtp(self): lines = [] for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): if l[12:16].strip() in ['PG', 'O1G', 'O2G', 'O3G', 'O3B', 'PB', 'O1B', 'O2B', 'O3A']: continue if l[12:16].strip() == 'PA': l = l.replace('PA', 'P ') if l[12:16].strip() == 'O1A': l = l.replace('O1A', 'O1P') if l[12:16].strip() == 'O2A': l = l.replace('O2A', 'O2P') if l[17:20].strip() == 'GTP': l = l[:17] + ' G' + l[20:] l = l.replace('HETATM', 'ATOM ') lines.append(l) self.lines = lines
[docs] def is_amber_like(self): """Use self.lines and check if there is XX line """ for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): rn = l[17:20] if rn in ['RU5', 'RC5', 'RA5', 'RT5', 'RG5']: self.report.append('This is amber-like format') return True return False
def replace_hetatms(self): nlines = [] for l in self.lines: l = l.replace('HETATM', 'ATOM ') nlines.append(l) self.lines = nlines
[docs] def fix_with_qrnas(self, outfn="", verbose=False): """Add missing heavy atom. A residue is recognized base on a residue names. Copy QRNAS folder to curr folder, run QRNAS and remove QRNAS. .. warning:: QRNAS required (http://genesilico.pl/QRNAS/QRNAS.tgz) """ from rpt_config import QRNAS_PATH # prepare folder get ff folder to_go = os.path.abspath(os.path.dirname(self.fn)) curr = os.getcwd() # set occupancy to 0 s = RNAStructure(self.fn) s.set_occupancy_atoms(0.00) s.write(self.fn) os.chdir(to_go) try: shutil.copytree(QRNAS_PATH, to_go + os.sep + "QRNAS") except OSError: pass # prepare config file with open('qrna_config.txt', 'w') as f: f.write("WRITEFREQ 1\n") f.write("NSTEPS 1\n") # run qrnas print('QRNAS...') if not outfn: cmd = "QRNAS -c qrna_config.txt -i " + os.path.basename(self.fn) else: cmd = "QRNAS -c qrna_config.txt -i " + \ os.path.basename(self.fn) + " -o " + curr + os.sep + outfn #o = subprocess.Popen(cmd, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE) os.system(cmd) if False: out = o.stdout.read().strip() err = o.stderr.read().strip() if verbose: print(out) print(err) shutil.rmtree(to_go + os.sep + "QRNAS") # post cleaning if outfn: print('Cleaning...') s = RNAStructure(curr + os.sep + outfn) s.remove_hydrogen() s.std_resn() s.write(curr + os.sep + outfn) os.chdir(curr)
def mol2toPDB(self, outfn=""): try: import pybel except ImportError: print ('pybel is needed for mol2 to pdb convertion') # sys.exit(1) sys.exit(0) if not outfn: outfn = self.fn.replace('.mol2', '.pdb') for mol in pybel.readfile("mol2", self.fn): mol.write("pdb", outfn, overwrite=True) print('outfn: ', outfn) self.report.append(' Converted from mol2 to PDB') return outfn def get_no_lines(self): return len(self.lines)
[docs] def check_geometry(self, verbose=False): """Check for correct "Polymer linkage, it should be around 1.6Å with a sigma around 0.01. Carrascoza, F., Antczak, M., Miao, Z., Westhof, E. & Szachniuk, M. Evaluation of the stereochemical quality of predicted RNA 3D models in the RNA-Puzzles submissions. Rna 28, 250–262 (2022). Values for 1xjr.pdb:: op.mean(): 1.599316 op.std(): 0.009274074 po.mean(): 1.5984017 po.std(): 0.0069191623 requires biopython """ if verbose: logger.setLevel(logging.DEBUG) try: from Bio import PDB from Bio.PDB import PDBIO import warnings warnings.filterwarnings('ignore', '.*Invalid or missing.*',) warnings.filterwarnings('ignore', '.*with given element *',) except: sys.exit('Error: Install biopython to use this function (pip biopython)') pdb = self.fn struc = PDB.PDBParser().get_structure('struc', pdb) resi_prev = {} op = [] po = [] angles = [] angles2 = [] p_ps = [] sigma = 0.009274074 mean = 1.599316 po3p_p = [] import numpy as np dist_o3pp= [] for s in struc: for c in s: # for new chain reset resi_prev resi_prev = None for r in c: if resi_prev: p_p = resi_prev["P"] - r['P'] p_ps.append(p_p) v = resi_prev["O3'"] - r['P'] po3p_p = resi_prev["O3'"] - r['P'] op.append(v) import math dist_o3pp.append(abs(1.6 - v)) x = mean - 12 * sigma y = mean + 12 * sigma v2 = r["P"] - r["O5'"] #ic(v2) po.append(v2) #ic(x, v, y) if not (x <= v <= y): print(f' ! lack of connectivity between {r}, {resi_prev}, distance between residues: {v:.2f}') pass # angle o3' p o5' pc3p = resi_prev["C3'"].get_vector() po3p = resi_prev["O3'"].get_vector() p = r['P'].get_vector() v1 = po3p - p v2 = po3p - pc3p angle = np.rad2deg(v1.angle(v2))#o5p)) angles.append(angle) # agnle o3'-p-o5' angle o5p = r["O5'"].get_vector() v1 = po3p - p v2 = o5p - p angle2 = np.rad2deg(v2.angle(v1)) angles2.append(angle2) resi_prev = r #ic(dist_o3pp, len(dist_o3pp), np.mean(dist_o3pp)) # Colors RED = "\033[31m" GREEN = "\033[32m" YELLOW = "\033[33m" BLUE = "\033[34m" RESET = "\033[0m" ic(np.array(op)) # Create a boxplot import numpy as np import pandas as pd import seaborn as sns import matplotlib.pyplot as plt df = pd.DataFrame(op, columns=["Values"]) # Assuming df is your DataFrame sns.histplot(data=df, x="Values")#, bins=200)#, kde=True) # kde=True adds a density curve plt.title("Histogram of O3'-P distances for 2o44.pdb") plt.xlabel("Values") plt.ylabel("Frequency") percentile_95 = np.percentile(df['Values'], 95) percentile_05 = np.percentile(df['Values'], 5) # Add a vertical line for the 95th percentile plt.axvline(percentile_95, color='red', linestyle='--', linewidth=1, label=f"95th Percentile: {percentile_95:.2f}") plt.axvline(percentile_05, color='blue', linestyle='--', linewidth=1, label=f"05th Percentile: {percentile_05:.2f}") plt.legend() plt.show() #ic(dist_o3pp) #aaa print(f'Connectivity Score; {GREEN} {sum(dist_o3pp) } {RESET}') print('Connectivity Score; ', sum(dist_o3pp) / len(dist_o3pp)) p_ps = np.array(p_ps) plots = True ic(v) plots = False if plots: import matplotlib.pyplot as plt plt.hist(op, bins='auto') plt.xlim(-1, 10) plt.title("prev-o3' p") plt.show() #np.set_printoptions(threshold=np.inf) # ic.disable() ic(p_ps) ic(p_ps.mean(), p_ps.std()) if plots: import matplotlib.pyplot as plt plt.hist(p_ps, bins='auto') plt.title("p-ps") plt.xlim(0, 10) plt.show() #plt.savefig("histogram.png") # Save the figure as a PNG file op = np.array(op) ic(op.mean(), op.std()) po = np.array(po) ic(po.mean(), po.std()) print("c3'-o3'-p") angles = np.array(angles) ic(angles) ic(angles.mean(), angles.std()) import math angle_degrees = angles.mean() angle_radians = math.radians(angle_degrees) # Convert to radians cos_value = math.cos(angle_radians) # Calculate cosine ic(cos_value) coss = [] for a in angles: angle_radians = math.radians(a) cos_value = math.cos(angle_radians) # Calculate cosine coss.append(cos_value) coss = np.array(coss) ic(coss.std()) if plots: import matplotlib.pyplot as plt plt.hist(angles, bins='auto') plt.title("Histogram of angles o3'-p-o5'") plt.xlim(0, 360) plt.show() angles2 = np.array(angles2) print("o3'-p-o5'") ic(angles2) ic(angles2.mean(), angles2.std()) angle_degrees = angles2.mean() angle_radians = math.radians(angle_degrees) # Convert to radians cos_value = math.cos(angle_radians) # Calculate cosine ic(cos_value) coss = [] for a in angles2: angle_radians = math.radians(a) cos_value = math.cos(angle_radians) # Calculate cosine coss.append(cos_value) coss = np.array(coss) ic(coss.std()) if plots: import matplotlib.pyplot as plt plt.hist(angles2, bins='auto') plt.title("Histogram of angles c3'-o3'-p") plt.xlim(0, 360) plt.show()
#ic.enable()
[docs] def get_text(self, add_end=True): """works on self.lines.""" txt = '' for l in self.lines: if l.startswith('END'): continue # skip end txt += l + '\n' # .strip() if add_end: if not l.startswith('END'): txt += 'END' return txt.strip()
def get_chain(self, chain_id='A'): txt = '' for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): if l[21] == chain_id: txt += l.strip() + '\n' if l.startswith('TER'): if len(l) < 21: # this is only TER # ter = 'TER ' + str(self.get_atom_num(txt) + 1).rjust(5) + '\n' raise Exception('TER line has no chain id') else: if l[21] == chain_id: txt += l.strip() + '\n' ## ll = txt.strip().split('\n')[-1] # last line = ll ## print(ll) ## #if ll.startswith('TER'): # if the last line does not start with ter ## ter = self.set_res_code(ter, self.get_res_code(ll)) # + self.get_chain_id(l).rjust(11) ## print(ter) return txt.strip()
[docs] def rename_chain(self, chain_id_old, chain_id_new, debug=False): """Rename chains Args: chain_id_old (str): e.g., A chain_id_new (str): e.g., B debug (bool): show some diagnostics Returns: pdb content (txt) self.lines is updated with new lines """ txt = '' lines = [] for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM') or l.startswith('TER'): # TER try: l[21] except IndexError: continue if l[21] == chain_id_old: l = l[:21] + chain_id_new + l[22:] if debug: print(l) txt += l.strip() + '\n' # ok, actually keep all lines as it was lines.append(l) self.lines = lines return txt
def get_resn_uniq(self): res = set() for l in self.lines: r = l[17:20].strip().upper() res.add(r) return res def check_res_if_std_na(self): wrong = [] for r in self.res: if r not in RES: wrong.append(r) return wrong
[docs] def get_seq(self, compact=False, chainfirst=False, fasta=False, addfn='', color=False): """Get seq (v2) gets segments of chains with correct numbering Run:: python rna_pdb_seq.py input/1ykq_clx.pdb > 1ykq_clx A:101-111 GGAGCUCGCCC > 1ykq_clx B:201-238 GGGCGAGGCCGUGCCAGCUCUUCGGAGCAAUACUCGGC > 6_solution_0 A:1-19 26-113 117-172 GGCGGCAGGUGCUCCCGACGUCGGGAGUUAAAAGGGAAG Chains is ``{'A': {'header': 'A:1-19 26-113 117-172', 'resi': [1, 2, 3, ..., \ 19, 26, 27, ..., 172], 'seq': ['G', 'G', 'C', 'G', ... C', 'G', 'U', 'C']}}`` Chains are in other as the appear in the file. .. warning :: take only ATOM and HETATM lines. """ if addfn: addfn += ' ' # add space to file name seq = self.lines[0][19] chains = OrderedDict() resi_prev = None chain_prev = None for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): resi = int(l[22:26]) if resi_prev != resi: resname = l[17:20].strip() chain_curr = l[21] if resname in AMINOACID_CODES: resname = aa3to1(resname) if len(resname) == 'GTP': # DG -> g GTP resname = 'g' if len(resname) > 1: # DG -> g GTP resname = resname[-1].lower() try: chains[chain_curr]['resi'].append(resi) chains[chain_curr]['seq'].append(resname) except KeyError: chains[chain_curr] = {} chains[chain_curr]['resi'] = [] chains[chain_curr]['resi'].append(resi) chains[chain_curr]['seq'] = [] chains[chain_curr]['seq'].append(resname) resi_prev = resi chain_prev = chain_curr def color_seq(seq, color): if not color: return seq else: from termcolor import colored seqc = '' for s in seq: if s in ['G']: seqc += colored(s, 'green') elif s in ['A']: seqc += colored(s, 'red') elif s in ['T', 'U']: seqc += colored(s, 'blue') elif s in ['C']: seqc += colored(s, 'yellow') else: seqc += s return seqc for c in list(chains.keys()): header = c + ':' + str(chains[c]['resi'][0]) + '-' # add A:1- for i in range(1, len(chains[c]['resi'])): # start from second element if chains[c]['resi'][i] - chains[c]['resi'][i - 1] > 1: header += '' + str(chains[c]['resi'][i - 1]) + ' ' header += '' + str(chains[c]['resi'][i]) + '-' header += '' + str(chains[c]['resi'][-1]) chains[c]['header'] = header # add -163 (last element) if compact: txt = '' for c in list(chains.keys()): if chainfirst: txt += '' + chains[c]['header'].ljust(15) + color_seq(''.join(chains[c]['seq']), color) + ' ' elif fasta: txt += color_seq(''.join(chains[c]['seq']), color) + ' ' else: txt += color_seq(''.join(chains[c]['seq']), color) + ' # ' + chains[c]['header'] + ' ' return txt.strip() else: txt = '' for c in list(chains.keys()): txt += '>' + addfn + chains[c]['header'] + '\n' txt += color_seq(''.join(chains[c]['seq']), color) + '\n' # color ;-) return txt.strip()
def __get_seq(self): """get_seq DEPRECATED You get `chains` such as: OrderedDict([('A', {'header': 'A:1-47', 'seq': 'CGUGGUUAGGGCCACGUUAAAUAGUUGCUUAAGCCCUAAGCGUUGAU'}), ('B', {'header': 'B:48-58', 'seq': 'AUCAGGUGCAA'})]) .. warning:: take only ATOM and HETATM lines. """ seq = '' curri = int(self.lines[0][22:26]) seq = self.lines[0][19] chains = OrderedDict() curri = -100000000000000000000000000000000 # ugly chain_prev = None for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): resi = int(l[22:26]) if curri != resi: print(l) resname = l[17:20].strip() if len(resname) == 'GTP': # DG -> g GTP resname = 'g' if len(resname) > 1: # DG -> g GTP resname = resname[-1].lower() seq += resname chain_curr = l[21] # if distances between curr res and previevs is bigger than 1, then show it as a fragment if resi - curri > 1 and resi - curri < 100000000000000000000000000000000: # ugly hack print(resi - curri) chains[chain_prev]['header'] += '-' + str(resi_prev) if chain_prev != chain_curr and chain_prev: chains[chain_prev]['header'] += '-' + str(resi_prev) if chaoin_curr in chains: chains[chain_curr]['seq'] += resname else: chains[chain_curr] = dict() chains[chain_curr]['header'] = chain_curr + ':' + str(resi) # resi_prev) chains[chain_curr]['seq'] = resname resi_prev = resi chain_prev = chain_curr curri = resi chains[chain_prev]['header'] += '-' + str(resi_prev) seq = '' for c in list(chains.keys()): seq += '> ' + os.path.basename(self.fn) + ' ' + chains[c]['header'] + '\n' seq += chains[c]['seq'] + '\n' return seq.strip()
[docs] def get_info_chains(self): """return A:3-21 B:22-32 """ seq = '' curri = int(self.lines[0][22:26]) seq = self.lines[0][19] chains = OrderedDict() curri = -100000000000000 # ugly chain_prev = None for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): resi = int(l[22:26]) if curri != resi: resname = l[17:20].strip() if len(resname) == 'GTP': # DG -> g GTP resname = 'g' if len(resname) > 1: # DG -> g GTP resname = resname[-1].lower() seq += resname chain_curr = l[21] if chain_prev != chain_curr and chain_prev: chains[chain_prev]['header'] += '-' + str(resi_prev) if chain_curr in chains: chains[chain_curr]['seq'] += resname else: chains[chain_curr] = dict() chains[chain_curr]['header'] = chain_curr + ':' + str(resi) # resi_prev) chains[chain_curr]['seq'] = resname resi_prev = resi chain_prev = chain_curr curri = resi chains[chain_prev]['header'] += '-' + str(resi_prev) seq = '' for c in list(chains.keys()): seq += chains[c]['header'] + ' ' return seq.strip()
def detect_file_format(self): pass def detect_molecule_type(self): aa = [] na = [] for r in self.res: if r in AMINOACID_CODES: aa.append(r) if r in RESS: na.append(r) aa = float(len(aa)) / len(self.res) na = float(len(na)) / len(self.res) if aa == 0 and na == 0: return 'error' if aa > na: return '>protein< vs na', aa, na else: return 'protein vs >na<', aa, na def get_head(self): return '\n'.join(self.lines[:5]) def get_tail(self): return '\n'.join(self.lines[-5:]) def get_preview(self): t = '\n'.join(self.lines[:5]) t += '\n-------------------------------------------------------------------\n' t += '\n'.join(self.lines[-5:]) return t def remove_hydrogen(self): lines = [] for l in self.lines: if l[77:79].strip() == 'H': continue if l[12:16].strip() in HYDROGEN_NAMES: # if l[12:16].strip().startswith('H'): continue else: # print l[12:16] lines.append(l) self.lines = lines
[docs] def remove_water(self): """Remove HOH and TIP3""" lines = [] for l in self.lines: if l[17:21].strip() in ['HOH', 'TIP3', 'WAT']: continue else: lines.append(l) self.lines = lines
[docs] def remove_ion(self): """ TER 1025 U A 47 HETATM 1026 MG MG A 101 42.664 34.395 50.249 1.00 70.99 MG HETATM 1027 MG MG A 201 47.865 33.919 48.090 1.00 67.09 MG :rtype: object """ lines = [] for l in self.lines: element = l[76:78].strip().upper() element2 = l[17:20].strip().upper() if element in IONS: continue if element2 in IONS: continue else: lines.append(l) self.lines = lines
def fixU__to__U(self): lines = [] for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): rn = l[17:20] rn = rn.replace('G ', ' G') rn = rn.replace('U ', ' U') rn = rn.replace('C ', ' C') rn = rn.replace('A ', ' A') l = l[:16] + ' ' + rn + ' ' + l[21:] # print l.strip() # print l2 #l = l.replace(' U ', ' U ') #l = l.replace(' G ', ' G ') #l = l.replace(' A ', ' A ') #l = l.replace(' C ', ' C ') lines.append(l) print ('fixU__to__U OK') self.report.append(' Fix: U__ -> __U') self.lines = lines def resn_as_dna(self): lines = [] for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): # print l nl = l.replace('DA5', ' DA') # RA should be the last!!!! nl = nl.replace('DA3', ' DA') nl = nl.replace(' DA', ' DA') nl = nl.replace(' rA', ' DA') nl = nl.replace('DC5', ' DC') nl = nl.replace('DC3', ' DC') nl = nl.replace(' DC', ' DC') nl = nl.replace(' rC', ' DC') nl = nl.replace('DG5', ' DG') nl = nl.replace('DG3', ' DG') nl = nl.replace(' DG', ' DG') nl = nl.replace(' rG', ' DG') nl = nl.replace('DU5', ' DU') nl = nl.replace('DU3', ' DU') nl = nl.replace(' DU', ' DU') nl = nl.replace(' rU', ' DU') nl = nl.replace('DT5', ' DT') nl = nl.replace('DT3', ' DT') nl = nl.replace(' DT', ' DT') nl = nl.replace(' rT', ' DT') nl = nl.replace('C5M', 'C7 ') if l[17:20].strip() == 'G': nl = nl[:17] + ' DG' + nl[20:] if l[17:20].strip() == 'C': nl = nl[:17] + ' DC' + nl[20:] if l[17:20].strip() == 'T': nl = nl[:17] + ' DT' + nl[20:] if l[17:20].strip() == 'U': nl = nl[:17] + ' DU' + nl[20:] if l[17:20].strip() == 'A': nl = nl[:17] + ' DA' + nl[20:] lines.append(nl) if l.startswith("END") or l.startswith("TER"): lines.append(l) print ('resn_as_dna') self.report.append(' resn_as_dna') self.lines = lines
[docs] def fix_O_in_UC(self): """.. warning: remove RU names before using this function""" lines = [] for l in self.lines: # if l[12:16].strip() in # if l[12:16].strip().startswith('H'): nl = l.replace('O U', 'O2 U') nl = nl.replace('O C', 'O2 C') lines.append(nl) self.lines = lines
[docs] def fix_op_atoms(self): """Replace OXP' to OPX1, e.g ('O1P' -> 'OP1')""" lines = [] for l in self.lines: nl = l.replace('*', '\'') nl = nl.replace('O1P', 'OP1') nl = nl.replace('O2P', 'OP2') nl = nl.replace('O3P', 'OP3') lines.append(nl) self.lines = lines
[docs] def get_report(self): """ Returns: string: report, messages collected on the way of parsing this file """ return '\n'.join(self.report)
def is_rna(self): wrong = [] for r in self.res: if r.upper().strip() in ['RC', 'RU', 'RA', 'RG', 'RT']: if r not in wrong_res: wrong_res.append(r) return wrong_res def check_res_if_std_dna(self): wrong_res = [] for r in self.res: if r.upper().strip() in ['A', 'T', 'C', 'G']: if r not in wrong_res: wrong_res.append(r) return wrong_res def check_res_if_supid_rna(self): wrong_res = [] for r in self.res: if r.upper().strip() in ['RC', 'RU', 'RA', 'RG', 'RT']: if r not in wrong_res: wrong_res.append(r) return wrong_res def is_rna(self): for r in self.res: if r.upper().strip() in ['RC', 'RU', 'RA', 'RG', 'RT']: if r not in wrong_res: wrong_res.append(r) return wrong_res
[docs] def renum_atoms(self): """Renum atoms, from 1 to X for line; ATOM/HETATM""" lines = [] c = 1 for l in self.lines: l = l[:6] + str(c).rjust(5) + l[11:] c += 1 lines.append(l) self.lines = lines
[docs] def std_resn(self): """'Fix' residue names which means to change them to standard, e.g. RA5 -> A Works on self.lines, and returns the result to self.lines. Will change things like:: # URI -> U, URA -> U 1xjr_clx_charmm.pdb:ATOM 101 P URA A 5 58.180 39.153 30.336 1.00 70.94 rp13_Dokholyan_1_URI_CYT_ADE_GUA_hydrogens.pdb:ATOM 82 P URI A 4 501.633 506.561 506.256 1.00 0.00 P """ lines = [] for l in self.lines: nl = l.replace('RA5', ' A') # RA should be the last!!!! nl = nl.replace('RA3', ' A') nl = nl.replace('ADE', ' A') nl = nl.replace(' RA', ' A') nl = nl.replace(' rA', ' A') nl = nl.replace('RC5', ' C') nl = nl.replace('RC3', ' C') nl = nl.replace('CYT', ' C') nl = nl.replace(' RC', ' C') nl = nl.replace(' rC', ' C') nl = nl.replace('RG5', ' G') nl = nl.replace('RG3', ' G') nl = nl.replace('GUA', ' G') nl = nl.replace(' RG', ' G') nl = nl.replace(' rG', ' G') nl = nl.replace('RU5', ' U') nl = nl.replace('RU3', ' U') nl = nl.replace('URA', ' U') nl = nl.replace('URI', ' U') nl = nl.replace('URY', ' U') nl = nl.replace(' RU', ' U') nl = nl.replace(' rU', ' U') nl = nl.replace('RT5', ' T') nl = nl.replace('RT3', ' T') nl = nl.replace('THY', ' T') nl = nl.replace(' RT', ' T') nl = nl.replace(' rT', ' T') lines.append(nl) self.lines = lines
def check_res_if_std_prot(self): wrong = [] for r in self.res: if r not in AMINOACID_CODES: wrong.append(r) return wrong
[docs] def write(self, outfn='', verbose=False): """Write ```self.lines``` to a file (and add END file) Args: outfn (str): file to save, if outfn is '', then simply use self.fn verbose (Boolen): be verbose or not Returns: None """ if outfn == '': outfn = self.fn f = open(outfn, 'w') # test if there is anything to write, if not, it's likely that the # file is not a PDB file, e.g. .outCR if not self.lines: raise Exception('Nothing to write. Is the input a PDB file? ', self.fn) for l in self.lines: f.write(l + '\n') if not l.startswith('END'): f.write('END') f.close() if verbose: print('Write %s' % outfn)
[docs] def get_atom_num(self, line): """Extract atom number from a line of PDB file Arguments: * line = ATOM line from a PDB file Output: * atom number (int) """ return int(''.join([x for x in line[6:11] if x.isdigit()]))
[docs] def get_res_num(self, line): """Extract residue number from a line of PDB file Arguments: * line = ATOM line from a PDB file Output: * residue number as an integer """ return int(''.join([x for x in line[22:27] if x.isdigit()]))
[docs] def get_res_code(self, line): """Get residue code from a line of a PDB file """ #if not line.startswith('ATOM'): # return None return line[17:20]
def shift_atom_names(self): nlines = [] for l in self.lines: if l.startswith('ATOM'): atom_name = self.get_atom_code(l) l = self.set_atom_code(l, atom_name) nlines.append(l) self.lines = nlines def prune_elements(self): nlines = [] for l in self.lines: if l.startswith('ATOM'): l = l[:76] + ' ' + l[78:] nlines.append(l) self.lines = nlines
[docs] def get_atom_code(self, line): """Get atom code from a line of a PDB file """ if not line.startswith('ATOM'): return None return line[12:16].replace(' ', '').strip()
[docs] def get_atom_coords(self, line): """Get atom coordinates from a line of a PDB file """ if not line.startswith('ATOM'): return None return tuple(map(float, line[31:54].split()))
[docs] def set_atom_coords(self, line, x, y, z): """Get atom coordinates from a line of a PDB file """ line = line[:30] + (f"{x:>8.3f}") + line[38:] line = line[:38] + (f"{y:>8.3f}") + line[46:] line = line[:46] + (f"{z:>8.3f}") + line[54:] return line
def set_line_bfactor(self, line, bfactor): if not line.startswith('ATOM'): return None return line[:60] + (" %5.2f" % bfactor) + line[66:]
[docs] def set_atom_occupancy(self, line, occupancy): """set occupancy for line""" return line[:54] + (" %5.2f" % occupancy) + line[60:]
[docs] def set_atom_code(self, line, code): """Add atom name/code: ATOM 1 OP2 C A 1 29.615 36.892 42.657 1.00 1.00 O ^^^ ^ and element """ return line[:12] + ' ' + code + ' ' * (3 - len(code)) + line[16:77] + code[0] + line[78:]
[docs] def set_res_code(self, line, code): """ Args: lines code path (str): The path of the file to wrap field_storage (FileStorage): The :class:Y instance to wrap temporary (bool): Whether or not to delete the file when the File instance is destructed Returns: BufferedFileStorage: A buffered writable file descriptor """ return line[:17] + code.rjust(3) + line[20:]
def get_chain_id(self, line): return line[21:22]
[docs] def get_all_chain_ids(self): """ Returns: set: chain ids, e.g. set(['A', 'B']) """ chain_ids = [] for l in self.lines: chain_id = self.get_chain_id(l) if chain_id and chain_id not in chain_ids: chain_ids.append(chain_id) return chain_ids
def get_atom_index(self, line): try: return int(line[6:11]) except: return None def set_atom_index(self, line, index): return line[:6] + str(index).rjust(5) + line[11:] def reindex_atom_index(self): self.nlines = [] for i, l in enumerate(self.lines): nl = self.set_atom_index(l, i + 1) # start from 1 self.nlines.append(nl) self.lines = self.nlines return self.nlines def get_res_index(self, line): return int(line[22:26]) def set_res_index(self, line, index): return line[:22] + str(index).rjust(4) + line[26:] def set_chain_id(self, line, chain_id): return line[:21] + chain_id + line[22:]
[docs] def get_rnapuzzle_ready(self, renumber_residues=True, fix_missing_atoms=True, rename_chains=True, ignore_op3 = False, report_missing_atoms=True, keep_hetatm=False, backbone_only=False, no_backbone = False, bases_only = False, save_single_res = False, ref_frame_only = False, p_only = False, check_geometry = False, conect = False, conect_no_linkage = False, verbose=False): # :, ready_for="RNAPuzzle"): """Get rnapuzzle (SimRNA) ready structure. Clean up a structure, get current order of atoms. :param renumber_residues: boolean, from 1 to ..., second chain starts from 1 etc. :param fix_missing_atoms: boolean, superimpose motifs from the minilibrary and copy-paste missing atoms, this is super crude, so should be used with caution. Submission format @http://ahsoka.u-strasbg.fr/rnapuzzles/ Run :func:`rna_tools.rna_tools.lib.RNAStructure.std_resn` before this function to fix names. .. image:: ../pngs/rebuild_op1op2_backbone.png Figure: (Starting from left) input structure, structure with rebuilded atoms, and reference. The B fragment is observed in the reference used here as a “benchmark”, fragment A is reconstructed atoms (not observed in the reference"). 201122 - 170305 Merged with get_simrna_ready and fixing OP3 terminal added - 170308 Fix missing atoms for bases, and O2' .. image:: ../pngs/fix_missing_o_before_after.png Fig. Add missing O2' atom (before and after). .. image:: ../pngs/fix_missing_superposition.png Fig. The residue to fix is in cyan. The G base from the library in red. Atoms O4', C2', C1' are shared between the sugar (in cyan) and the G base from the library (in red). These atoms are used to superimpose the G base on the sugar, and then all atoms from the base are copied to the residues. .. image:: ../pngs/fix_missing_bases.png **Fig.** Rebuild ACGU base-less. It's not perfect but good enough for some applications. .. warning:: It was only tested with the whole base missing! .. warning:: requires: Biopython Selection of atoms: - posphate group (3x, OP1 ,P, OP2), - connector (2x O5', C5'), /5x - sugar (5x, C4', O4', C3', O3', C1', C2'), /10 - extra oxygens from sugar (2x, O2' O3'), for now it's /12! - A (10x), G (11x), C (8x), U(8x), max 12+11=23 And 27 unique atoms: {'N9', 'O2', 'OP2', "O2'", "O4'", 'C8', "O3'", "C1'", 'C2', 'C6', "C5'", 'N6', 'C5', "C4'", 'C4', "O5'", "C3'", 'O6', 'N2', 'N7', 'OP1', 'N1', 'N4', 'P', "C2'", 'N3', 'O4'}. """ if verbose: logger.setLevel(logging.DEBUG) try: from Bio import PDB from Bio.PDB import PDBIO import warnings warnings.filterwarnings('ignore', '.*Invalid or missing.*',) warnings.filterwarnings('ignore', '.*with given element *',) except: sys.exit('Error: Install biopython to use this function (pip biopython)') import copy # for debugging #renumber_residues = True # if ready_for == "RNAPuzzle": if p_only: G_ATOMS = "P".split() A_ATOMS = "P".split() U_ATOMS = "P".split() C_ATOMS = "P".split() elif backbone_only: G_ATOMS = "P OP1 OP2 O5' C5'".split() A_ATOMS = "P OP1 OP2 O5' C5'".split() U_ATOMS = "P OP1 OP2 O5' C5'".split() C_ATOMS = "P OP1 OP2 O5' C5'".split() #G_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1'".split() #A_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1'".split() #U_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1'".split() #C_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1'".split() elif ref_frame_only: G_ATOMS = "P OP1 OP2".split() A_ATOMS = "P OP1 OP2".split() U_ATOMS = "P OP1 OP2".split() C_ATOMS = "P OP1 OP2".split() elif no_backbone: G_ATOMS = "C5' C4' O4' C3' O3' C2' O2' C1' N9 C8 N7 C5 C6 O6 N1 C2 N2 N3 C4".split() A_ATOMS = "C5' C4' O4' C3' O3' C2' O2' C1' N9 C8 N7 C5 C6 N6 N1 C2 N3 C4".split() U_ATOMS = "C5' C4' O4' C3' O3' C2' O2' C1' N1 C2 O2 N3 C4 O4 C5 C6".split() C_ATOMS = "C5' C4' O4' C3' O3' C2' O2' C1' N1 C2 O2 N3 C4 N4 C5 C6".split() elif bases_only: G_ATOMS = "N9 C8 N7 C5 C6 O6 N1 C2 N2 N3 C4".split() A_ATOMS = "N9 C8 N7 C5 C6 N6 N1 C2 N3 C4".split() U_ATOMS = "N1 C2 O2 N3 C4 O4 C5 C6".split() C_ATOMS = "N1 C2 O2 N3 C4 N4 C5 C6".split() else: G_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N9 C8 N7 C5 C6 O6 N1 C2 N2 N3 C4".split() # 23 A_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N9 C8 N7 C5 C6 N6 N1 C2 N3 C4".split() # 22 U_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N1 C2 O2 N3 C4 O4 C5 C6".split() # 20 C_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N1 C2 O2 N3 C4 N4 C5 C6".split() # 20 # hmm.. is it the same as RNApuzzle??? # if ready_for == "SimRNA": # G_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N9 C8 N7 C5 C6 O6 N1 C2 N2 N3 C4".split() # A_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N9 C8 N7 C5 C6 N6 N1 C2 N3 C4".split() # U_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N1 C2 O2 N3 C4 O4 C5 C6".split() # C_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N1 C2 O2 N3 C4 N4 C5 C6".split() tf = tempfile.NamedTemporaryFile(delete=False) ftmp = tf.name self.write(ftmp, verbose=False) parser = PDB.PDBParser() #try: struct = parser.get_structure('', ftmp) #except: # print('Error in ' + self.fn) # sys.exit(1) model = struct[0] s2 = PDB.Structure.Structure(struct.id) m2 = PDB.Model.Model(model.id) chains2 = [] missing = [] fixed = [] protein_chains_remmoved = [] new_chains = list(string.ascii_uppercase) remarks = [] if ignore_op3: remarks.append("REMARK 250 don't add OP3 at the start of chain") # get path to mini db with models to rebuilt structures currfn = __file__ if currfn == '': path = '.' else: path = os.path.dirname(currfn) if os.path.islink(currfn): # path + os.sep + os.path.basename(__file__)): path = os.path.dirname(os.readlink( path + os.sep + os.path.basename(currfn))) # for each chain # for chain in model.get_list(): logger.debug('chain: %s' % chain) # is it RNA? ############################ protein_like = 0 for c, r in enumerate(chain, 1): if r.resname in AMINOACID_CODES: protein_like += 1 if (protein_like / float(c + 1)) > .8: # 90% protein_chains_remmoved.append(chain.get_id()) # ###################################### res = [] for r in chain: res.append(r) res = copy.copy(res) # start chains from A..BCD. etc if rename_chains: try: chain.id = new_chains.pop(0) except ValueError: # ValueError: Cannot change id from `A` to `A`. # The id `A` is already used for a sibling of this entity. # so keep it as it was pass c2 = PDB.Chain.Chain(chain.id) c = 1 # new chain, goes from 1 !!! if renumber True prev_r = '' # init prev_r conects = [] atom_index = 0 for r in res: # # deal with heteratm # if r.id[0].startswith('H_') or r.id[0].startswith('W'): if keep_hetatm: c2.add(r) else: # str(r) % r.id[0].replace('H_', '').strip()) remarks.append('REMARK 250 Hetatom to be removed from file: ' + str(r)) continue # hack for amber/qrna r.resname = r.resname.strip() if r.resname == 'RC3': r.resname = 'C' if r.resname == 'RU3': r.resname = 'U' if r.resname == 'RG3': r.resname = 'G' if r.resname == 'RA3': r.resname = 'A' if r.resname == 'C3': r.resname = 'C' if r.resname == 'U3': r.resname = 'U' if r.resname == 'G3': r.resname = 'G' if r.resname == 'A3': r.resname = 'A' if r.resname == 'RC5': r.resname = 'C' if r.resname == 'RU5': r.resname = 'U' if r.resname == 'RG5': r.resname = 'G' if r.resname == 'RA5': r.resname = 'A' if r.resname == 'C5': r.resname = 'C' if r.resname == 'U5': r.resname = 'U' if r.resname == 'G5': r.resname = 'G' if r.resname == 'A5': r.resname = 'A' if r.resname.strip() == 'RC': r.resname = 'C' if r.resname.strip() == 'RU': r.resname = 'U' if r.resname.strip() == 'RG': r.resname = 'G' if r.resname.strip() == 'RA': r.resname = 'A' # unmodified rna 2MG -> G and take only G atoms if (r.resname.strip() not in ['C', 'U', 'G', 'A']) and \ (r.resname.strip()[-1] in ['C', 'U', 'G', 'A']): r.resname = r.resname.strip()[-1].strip() r2 = PDB.Residue.Residue(r.id, r.resname.strip(), r.segid) if renumber_residues: r2.id = (r2.id[0], c, r2.id[2]) # renumber residues # # experimental: fixing missing OP3. # Only for the first residues. # if c == 1: # if p_missing p_missing = True # if p_missing: # try: # x = r["O5'"] # x.id = ' P' # x.name = ' P' # x.fullname = ' P' # print "REMARK 000 FIX O5' -> P fix in chain ", chain.id # except: # pass for a in r: if a.id == 'P': p_missing = False logger.debug('p_missing %s' % p_missing) if p_missing and fix_missing_atoms: currfn = __file__ if currfn == '': path = '.' else: path = os.path.dirname(currfn) if os.path.islink(currfn): # path + os.sep + os.path.basename(__file__)): path = os.path.dirname(os.readlink( path + os.sep + os.path.basename(currfn))) po3_struc = PDB.PDBParser().get_structure('', path + '/data/PO3_inner.pdb') po3 = [po3_atom for po3_atom in po3_struc[0].get_residues()][0] r_atoms = [r["O4'"], r["C4'"], r["C3'"]] po3_atoms = [po3["O4'"], po3["C4'"], po3["C3'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, po3_atoms) rms = round(sup.rms, 3) sup.apply(po3_struc.get_atoms()) # to all atoms of po3 r.add(po3['P']) r.add(po3['OP1']) r.add(po3['OP2']) try: r.add(po3["O5'"]) except: del r["O5'"] r.add(po3["O5'"]) fixed.append(['add OP3 at the beginning of the chain ', chain.id, r, r.id[1]]) p_missing = False # off this function # save it #io = PDB.PDBIO() #io.set_structure( po3_struc ) # io.save("po3.pdb") # # fix missing O2' # o2p_missing = True for a in r: logger.debug('o2p_missing: %s %s %s' % (r, o2p_missing, a.id)) if a.id == "O2'": o2p_missing = False logger.debug('o2p_missing: %s', o2p_missing) if o2p_missing and fix_missing_atoms: currfn = __file__ if currfn == '': path = '.' else: path = os.path.dirname(currfn) if os.path.islink(currfn): # path + os.sep + os.path.basename(__file__)): path = os.path.dirname(os.readlink( path + os.sep + os.path.basename(currfn))) o2p_struc = PDB.PDBParser().get_structure('', path + '/data/o2prim.pdb') o2p = [o2p_atom for o2p_atom in o2p_struc[0].get_residues()][0] try: r_atoms = [r["C3'"], r["C2'"], r["C1'"]] except: ic(r) o2p_atoms = [o2p["C3'"], o2p["C2'"], o2p["C1'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, o2p_atoms) rms = round(sup.rms, 3) sup.apply(o2p_struc.get_atoms()) # to all atoms of o2p r.add(o2p["O2'"]) logger.debug('fixing o2p for ' % r) fixed.append(['add O2\' ', chain.id, r, c]) o2p_missing = False # off this function ######## fixing of missing OP1 and OP2 atoms in backbone ########### if fix_missing_atoms: if 'OP1' not in r: if prev_r: op4 = PDB.PDBParser().get_structure('', path + '/data/op4.pdb') op4a = [a for a in op4[0].get_residues()][0] if 'P' not in r: print("Error missing P of residue " + chain.id + ':' + str(r.id[1]) + ". Sorry, I can't rebuild missing atoms!") exit() r_atoms = [r["O5'"], r["P"], prev_r["O3'"]] # r["C5'"], op4_atoms = [op4a["O5'"], op4a["P"], op4a["O3'"]] # op4a["C5'"]] #, sup = PDB.Superimposer() sup.set_atoms(r_atoms, op4_atoms) sup.apply(op4.get_atoms()) r.add(op4a["OP1"]) r.add(op4a["OP2"]) fixed.append(['add the missing OP1 and OP2', chain.id, r, r.id[1]]) else: remarks.append("REMARK 250 Warning: Can't fix missing OP1 or/and OP2 atoms of " + str(r)) # # fix missing C (the whole base at the moment) # if str(r.get_resname()).strip() == "C" and fix_missing_atoms: for a in r: if a.id == "N1": break else: C_struc = PDB.PDBParser().get_structure('', path + '/data/C.pdb') C = [C_atom for C_atom in C_struc[0].get_residues()][0] r_atoms = [r["O4'"], r["C2'"], r["C1'"]] C_atoms = [C["O4'"], C["C2'"], C["C1'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, C_atoms) rms = round(sup.rms, 3) sup.apply(C_struc.get_atoms()) # to all atoms of C r.add(C["N1"]) r.add(C["C2"]) r.add(C["O2"]) r.add(C["N3"]) r.add(C["C4"]) r.add(C["N4"]) r.add(C["C5"]) r.add(C["C6"]) fixed.append(['add the whole base C', chain.id, r, r.id[1]]) # # fix missing U (the whole base at the moment) # if str(r.get_resname()).strip() == "U" and fix_missing_atoms: for a in r: if a.id == "N1": break else: U_struc = PDB.PDBParser().get_structure('', path + '/data/U.pdb') U = [U_atom for U_atom in U_struc[0].get_residues()][0] r_atoms = [r["O4'"], r["C2'"], r["C1'"]] U_atoms = [U["O4'"], U["C2'"], U["C1'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, U_atoms) rms = round(sup.rms, 3) sup.apply(U_struc.get_atoms()) # to all atoms of U r.add(U["N1"]) r.add(U["C2"]) r.add(U["O2"]) r.add(U["N3"]) r.add(U["C4"]) r.add(U["O4"]) r.add(U["C5"]) r.add(U["C6"]) fixed.append(['add the whole base U', chain.id, r, r.id[1]]) # # fix missing G (the whole base at the moment) # if str(r.get_resname()).strip() == "G" and fix_missing_atoms: for a in r: if a.id == "N1": break else: G_struc = PDB.PDBParser().get_structure('', path + '/data/G.pdb') G = [G_atom for G_atom in G_struc[0].get_residues()][0] r_atoms = [r["O4'"], r["C2'"], r["C1'"]] G_atoms = [G["O4'"], G["C2'"], G["C1'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, G_atoms) rms = round(sup.rms, 3) sup.apply(G_struc.get_atoms()) # to all atoms of G r.add(G["N9"]) r.add(G["C8"]) r.add(G["N7"]) r.add(G["C5"]) r.add(G["C6"]) r.add(G["O6"]) r.add(G["N1"]) r.add(G["C2"]) r.add(G["N2"]) r.add(G["N3"]) r.add(G["C4"]) fixed.append(['add the whole base G', chain.id, r, r.id[1]]) # # fix missing A (the whole base at the moment) # if str(r.get_resname()).strip() == "A" and fix_missing_atoms: for a in r: if a.id == "N1": break else: A_struc = PDB.PDBParser().get_structure('', path + '/data/A.pdb') A = [A_atom for A_atom in A_struc[0].get_residues()][0] r_atoms = [r["O4'"], r["C2'"], r["C1'"]] A_atoms = [A["O4'"], A["C2'"], A["C1'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, A_atoms) rms = round(sup.rms, 3) sup.apply(A_struc.get_atoms()) # to all atoms of A r.add(A["N9"]) r.add(A["C8"]) r.add(A["N7"]) r.add(A["C5"]) r.add(A["C6"]) r.add(A["N6"]) r.add(A["N1"]) r.add(A["C2"]) r.add(A["N3"]) r.add(A["C4"]) fixed.append(['add the whole base A', chain.id, r, r.id[1]]) # # strip residues of extra atoms, not in G_ATOMS in this case # if str(r.get_resname()).strip() == "G": for an in G_ATOMS: if c == 1 and ignore_op3: if an in ['P', 'OP1', 'OP2']: continue try: if c == 1 and an == "O5'" and p_missing: r2.add(x) else: r2.add(r[an]) except KeyError: # print 'Missing:', an, r, ' new resi', c missing.append([an, chain.id, r, r.id[1]]) c2.add(r2) elif str(r.get_resname()).strip() == "A": for an in A_ATOMS: if c == 1 and ignore_op3: if an in ['P', 'OP1', 'OP2']: continue try: if c == 1 and an == "O5'" and p_missing: r2.add(x) else: r2.add(r[an]) except KeyError: # print 'Missing:', an, r, ' new resi', c missing.append([an, chain.id, r, r.id[1]]) c2.add(r2) elif str(r.get_resname()).strip() == "C": for an in C_ATOMS: if c == 1 and ignore_op3: if an in ['P', 'OP1', 'OP2']: continue try: if c == 1 and an == "O5'" and p_missing: r2.add(x) else: r2.add(r[an]) except: # print 'Missing:', an, r, ' new resi', c missing.append([an, chain.id, r, r.id[1]]) c2.add(r2) elif str(r.get_resname()).strip() == "U": for an in U_ATOMS: if c == 1 and ignore_op3: if an in ['P', 'OP1', 'OP2']: continue try: if c == 1 and an == "O5'" and p_missing: r2.add(x) else: r2.add(r[an]) except KeyError: # print 'Missing:', an, r,' new resi', c missing.append([an, chain.id, r, r.id[1]]) c2.add(r2) # save each residue a sa single ife if save_single_res: from Bio.PDB import Structure # Create an empty structure structure = Structure.Structure("my_structure") model = Model.Model(0) chain = Chain.Chain('A') chain.add(r2) model.add(chain) structure.add(model) io = PDBIO() io.set_structure(structure) io.save(f"{self.fn}_{r2.id[1]}.pdb") # add CONET if conect: ic(atom_index, r2) conects.extend(generate_conect_records(r2.get_resname().strip(), atom_index, conect_no_linkage)) atom_index += len(r2) print(conect) prev_r = r # hack to keep preview residue to be used in the function # e.g., to get an atom from this residue c += 1 chains2.append(c2) io = PDBIO() s2.add(m2) for chain2 in chains2: m2.add(chain2) # print c2 # print m2 io.set_structure(s2) tf = tempfile.NamedTemporaryFile(delete=False) fout = tf.name io.save(fout) if fixed: remarks.append('REMARK 250 Fixed atoms/residues:') for i in fixed: remarks.append( ' '.join(['REMARK 250 -', str(i[0]), 'in chain:', str(i[1]), str(i[2]), 'residue #', str(i[3])])) if missing and report_missing_atoms: remarks.append('REMARK 250 Missing atoms:') for i in missing: remarks.append(' '.join(['REMARK 250 +', str(i[0]), 'chain:', str(i[1]), str(i[2]), 'residue #', str(i[3])])) #raise Exception('Missing atoms in %s' % self.fn) if protein_chains_remmoved: remarks.append('REMARK 250 Chains that seem to be proteins removed and : ' + ' '.join(protein_chains_remmoved)) # # fix ter 'TER' -> TER 1528 G A 71 # s = RNAStructure(fout) if check_geometry: s.check_geometry() self.lines = s.lines c = 0 # ATOM 1527 C4 G A 71 0.000 0.000 0.000 1.00 0.00 C nlines = [] no_ters = 0 for l in self.lines: ## align atoms to the left ####################################################### # ATOM 3937 P C B 185 11.596 -7.045 26.165 1.00 0.00 P # ATOM 3937 P C B 185 11.596 -7.045 26.165 1.00 0.00 P if l.startswith('ATOM'): atom_code = self.get_atom_code(l) l = self.set_atom_code(l, atom_code) ################################################################################## if l.startswith('TER'): # pass # leave it for now this atom_l = self.lines[c - 1] new_l = 'TER'.ljust(80) # TER 1528 G A 71 <<<' new_l = self.set_atom_index(new_l, str(self.get_atom_index(atom_l) + 1 + no_ters)) new_l = self.set_res_code(new_l, self.get_res_code(atom_l)) new_l = self.set_chain_id(new_l, self.get_chain_id(atom_l)) new_l = self.set_res_index(new_l, self.get_res_index(atom_l)) nlines.append(new_l) #nlines.append(l)file:/Users/magnus/Desktop/3nt_rpr.pdb no_ters += 1 else: if self.get_atom_index(l): l = self.set_atom_index(l, self.get_atom_index( l) + no_ters) # 1 ter +1 2 ters +2 etc nlines.append(l) c += 1 self.lines = nlines if conect: self.lines += conects return remarks
[docs] def set_occupancy_atoms(self, occupancy): """ :param occupancy: """ nlines = [] for l in self.lines: if l.startswith('ATOM'): l = self.set_atom_occupancy(l, 0.00) nlines.append(l) else: nlines.append(l) self.lines = nlines
[docs] def edit_occupancy_of_pdb(txt, pdb, pdb_out, v=False): """Make all atoms 1 (flexi) and then set occupancy 0 for seletected atoms. Return False if error. True if OK """ struc = PDB.PDBParser().get_structure('struc', pdb) txt = txt.replace(' ', '') if v: print (txt) l = re.split('[,:;]', txt) if v: print (l) for s in struc: for c in s: for r in c: for a in r: a.set_occupancy(1) # make it flaxi for i in l: # ['A', '1-10', '15', '25-30', 'B', '1-10'] if i in string.ascii_letters: if v: print('chain', i) chain_curr = i continue if i.find('-') > -1: start, ends = i.split('-') if start > ends: print('Error: range start > end ' + i) # >>sys.stderr return False index = list(range(int(start), int(ends) + 1)) else: index = [int(i)] for i in index: # change b_factor try: atoms = struc[0][chain_curr][i] except KeyError: if i == chain_curr: print('Error: Chain ' + chain_curr + ' not found in the PDB structure') # >>sys.stderr, else: print('Error: Residue ' + chain_curr + ':' + str(i) + ' found in the PDB structure') # >>sys.stderr, return False for a in atoms: a.set_occupancy(0) io = PDBIO() io.set_structure(struc) io.save(pdb_out) print('Saved ', pdb_out) return True
def view(self): os.system('pymol ' + self.fn)
[docs] def remove(self, verbose): """Delete file, self.fn""" os.remove(self.fn) if verbose: 'File %s removed' % self.fn
def __repr__(self): return 'RNAStructure %s' % self.fn
[docs] def get_remarks_text(self): """Get remarks as text for given file. This function re-open files, as define as self.fn to get remarks. Example:: r = RNAStructure(fout) remarks = r.get_remarks_txt() r1 = r.get_res_txt('A', 1) r2 = r.get_res_txt('A', 2) r3 = r.get_res_txt('A', 3) with open(fout, 'w') as f: f.write(remarks) f.write(r1) f.write(r2) f.write(r3) remarks is REMARK 250 Model edited with rna-tools REMARK 250 ver 3.5.4+63.g4338516.dirty REMARK 250 https://github.com/mmagnus/rna-tools REMARK 250 Fri Nov 13 10:15:19 2020 """ txt = '' for l in open(self.fn): if l.startswith("REMARK"): txt += l return txt
[docs] def get_res_text(self, chain_id, resi): """Get a residue of given resi of chain_id and return as a text Args: chain_id (str): e.g., 'A' resi (int): e.g., 1 Returns: txt: Example:: r = RNAStructure(fn) print(r.get_res_txt('A', 1)) ATOM 1 O5' G A 1 78.080 -14.909 -0.104 1.00 9.24 O ATOM 2 C5' G A 1 79.070 -15.499 -0.956 1.00 9.70 C ATOM 3 C4' G A 1 78.597 -16.765 -1.648 1.00 9.64 C ATOM 4 O4' G A 1 78.180 -17.761 -0.672 1.00 9.88 O (...) """ txt = '' for l in self.lines: if l.startswith("ATOM"): if self.get_res_num(l) == resi and self.get_chain_id(l) == chain_id: txt += l + '\n' return txt
def mq(self, method="RASP", verbose=False): if method.lower() == "rasp": from rna_tools.tools.mq.RASP import RASP r = RASP.RASP() return [float(i) for i in r.run(self.fn, potentials=['all'])] # ['-42058.4', '466223', '-0.0902109', '0', '0', '0'] if method.lower() == "dfire": from rna_tools.tools.mq.Dfire import Dfire r = Dfire.Dfire() return r.run(self.fn, verbose) if method.lower() == "rna3dcnn": from rna_tools.tools.mq.RNA3DCNN import RNA3DCNN r = RNA3DCNN.RNA3DCNN() return r.run(self.fn, verbose) if method.lower() == "qrna": from rna_tools.tools.mq.QRNA import QRNA r = QRNA.QRNA() return r.run(self.fn, verbose) if method.lower() == "clashscore": from rna_tools.tools.mq.ClashScore import ClashScore r = ClashScore.ClashScore() return r.run(self.fn, verbose) if method.lower() == "analyzegeometry": from rna_tools.tools.mq.AnalyzeGeometry import AnalyzeGeometry r = AnalyzeGeometry.AnalyzeGeometry() return r.run(self.fn, verbose) raise MethodUnknown('Define corrent method') def get_empty_line(self): l = "ATOM 1 C5' A A 3 25.674 19.091 3.459 1.00 1.00 X" return l def add_line(self, l): self.lines.append(l)
def add_header(version=None): now = time.strftime("%c") txt = 'REMARK 250 Model edited with rna-tools\n' txt += 'REMARK 250 ver %s \nREMARK 250 https://github.com/mmagnus/rna-tools \nREMARK 250 %s' % ( version, now) return txt
[docs] def edit_pdb(f, args): """Edit your structure. The function can take ``A:3-21>A:1-19`` or even syntax like this ``A:3-21>A:1-19,B:22-32>B:20-30`` and will do an editing. The output is printed, line by line. Only ATOM lines are edited! Examples:: $ rna_pdb_tools.py --edit 'A:3-21>A:1-19' 1f27_clean.pdb > 1f27_clean_A1-19.pdb or even:: $ rna_pdb_tools.py --edit 'A:3-21>A:1-19,B:22-32>B:20-30' 1f27_clean.pdb > 1f27_clean_renumb.pdb """ # open a new file s = RNAStructure(f) output = '' if not args.no_hr: output += add_header() + '\n' output += 'REMARK 250 HEADER --edit ' + args.edit + '\n' # --edit 'A:3-21>A:1-19,B:22-32>B:20-30' if args.edit.find(',') > -1: # more than one edits edits = args.edit.split(',') # ['A:3-21>A:1-19', 'B:22-32>B:20-30'] selects = [] for e in edits: selection_from, selection_to = select_pdb_fragment( e.split('>')[0]), select_pdb_fragment(e.split('>')[1]) if len(selection_to) != len(selection_from): raise Exception('len(selection_to) != len(selection_from)') selects.append([selection_from, selection_to]) else: # one edit e = args.edit selection_from, selection_to = select_pdb_fragment( e.split('>')[0]), select_pdb_fragment(e.split('>')[1]) if len(selection_to) != len(selection_from): raise Exception('len(selection_to) != len(selection_from)') selects = [[selection_from, selection_to]] # go ever all edits: ['A:3-21>A:1-19','B:22-32>B:20-30'] for l in s.lines: if l.startswith('ATOM'): # get chain and resi chain = l[21:22].strip() resi = int(l[22:26].strip()) if_selected_dont_print = False # for selections for select in selects: selection_from, selection_to = select if chain in selection_from: if resi in selection_from[chain]: # [1,2,3] mapping from [4,5,10], you want to know how to map 1 # 1 is [0] element of first list, so you have to index first list # to get 0, with this 0 you can get 4 out of second list [4,5,10][0] -> 4 nl = list(l) chain_new = list(selection_to.keys())[0] # chain form second list nl[21] = chain_new # new chain index = selection_from[chain].index(int(resi)) # get index of 1 resi_new = str(selection_to[chain_new][index]).rjust( 4) # 'A' [1,2,3] -> ' 1' nl[22:26] = resi_new nl = ''.join(nl) if_selected_dont_print = True output += nl + '\n' if not if_selected_dont_print: output += l + '\n' else: # if not atom output += l + '\n' return output
[docs] def collapsed_view(args): """Collapsed view of pdb file. Only lines with C5' atoms are shown and TER, MODEL, END. example:: [mm] rna_tools git:(master) $ python rna-pdb-tools.py --cv input/1f27.pdb ATOM 1 C5' A A 3 25.674 19.091 3.459 1.00 16.99 C ATOM 23 C5' C A 4 19.700 19.206 5.034 1.00 12.65 C ATOM 43 C5' C A 5 14.537 16.130 6.444 1.00 8.74 C ATOM 63 C5' G A 6 11.726 11.579 9.544 1.00 9.81 C ATOM 86 C5' U A 7 12.007 7.281 13.726 1.00 11.35 C ATOM 106 C5' C A 8 12.087 6.601 18.999 1.00 12.74 C TER""" r = RNAStructure(args.file) for l in r.lines: at = r.get_atom_code(l) if at == "P": # C5'": print(l) if l.startswith('TER') or l.startswith('MODEL') or l.startswith('END'): print(l)
[docs] def fetch(pdb_id, path="."): """fetch pdb file from RCSB.org https://files.rcsb.org/download/1Y26.pdb Args: - pdb_id, but also a chain can be specified, 1jj2:A+B+C Returns: - a path to a file TODO: na_pdb_tools.py --extract A:1-25+B:30-57 1jj2.pdb""" chains = '' pdb_id = pdb_id.replace('_', ':') # to accept also 1jj2_A if ':' in pdb_id: pdb_id, chains = pdb_id.split(':') # >>> 'X:A+B+C'.split(':') ['X', 'A+B+C'] if pdb_id == 'rp': os.system('wget https://github.com/RNA-Puzzles/standardized_dataset/archive/master.tar.gz -O - | tar -xz') return import urllib3 http = urllib3.PoolManager() # try: pdb_id = pdb_id.replace('.pdb', '') response = http.request('GET', 'https://files.rcsb.org/download/' + pdb_id + '.pdb') if not response.status == 200: raise PDBFetchError() # except urllib3.HTTPError: # raise Exception('The PDB does not exists: ' + pdb_id) txt = response.data if path != '.': npath = path + os.sep + pdb_id + '.pdb' else: npath = pdb_id + '.pdb' print('downloading... ' + npath) with open(npath, 'wb') as f: f.write(txt) if chains: for chain in chains.split('+'): cmd = f'rna_pdb_tools.py --extract-chain {chain} {pdb_id}.pdb > {pdb_id}_{chain}.pdb' print(cmd) exe(cmd) # print('ok') return npath
[docs] def fetch_ba(pdb_id, path="."): """fetch biological assembly pdb file from RCSB.org >>> fetch_ba('1xjr') ... """ try: import urllib3 except ImportError: print('urllib3 is required') return http = urllib3.PoolManager() # try: response = http.request('GET', url='https://files.rcsb.org/download/' + pdb_id.lower() + '.pdb1') if not response.status == 200: raise PDBFetchError() txt = response.data npath = path + os.sep + pdb_id + '_ba.pdb' print('downloading...' + npath) with open(npath, 'wb') as f: f.write(txt) print('ok') return pdb_id + '_ba.pdb'
[docs] def fetch_cif_ba(cif_id, path="."): """fetch biological assembly cif file from RCSB.org""" import urrlib3 http = urllib3.PoolManager() # try: response = http.request('GET', url='https://files.rcsb.org/download/' + cif_id.lower() + '-assembly1.cif') if not response.status == 200: raise PDBFetchError() txt = response.data npath = path + os.sep + cif_id + '_ba.cif' print('downloading...' + npath) with open(npath, 'wb') as f: f.write(txt) print('ok') return cif_id + '_ba.cif'
[docs] def fetch_cif(cif_id, path="."): """fetch biological assembly cif file from RCSB.org""" import urllib3 http = urllib3.PoolManager() # try: if '_' in cif_id: cif_id = cif_id.split('_')[0] ic(cif_id) cif_id = cif_id.replace('.cif', '') url = 'https://files.rcsb.org/download/' + cif_id.lower() + '.cif' print(url) response = http.request('GET', url) if not response.status == 200: raise PDBFetchError() txt = response.data npath = path + os.sep + cif_id + '.cif' #print('downloading... ' + npath) with open(npath, 'wb') as f: f.write(txt) return cif_id + '.cif'
[docs] def replace_chain(struc_fn, insert_fn, chain_id): """Replace chain of the main file (struc_fn) with some new chain (insert_fn) of given chain id. Args: struc_fn (str): path to the main PDB file insert_fn (str): path to the file that will be injected in into the main PDB file chain_id (str): chain that will be inserted into the main PDB file Returns: string: text in the PDB format """ struc = RNAStructure(struc_fn) insert = RNAStructure(insert_fn) output = '' inserted = False for l in struc.lines: if l.startswith('ATOM'): chain = l[21] if chain == chain_id: if not inserted: for insertl in insert.lines: if not insertl.startswith('HEADER') and not insertl.startswith('END'): output += insertl + '\n' inserted = True continue # insert pdb output += l + '\n' return output.strip()
[docs] def replace_atoms(struc_fn, insert_fn, verbose=False): """Replace XYZ coordinate of the file (struc_fn) with XYZ from another file (insert_fn). This can be useful if you want to replace positions of atoms, for example, one base only. The lines are muted based on atom name, residue name, chain, residue index (marked with XXXX below).:: ATOM 11 N1 A 2 27 303.441 273.472 301.457 1.00 0.00 N # file ATOM 1 N1 A 2 27 300.402 273.627 303.188 1.00 99.99 N # insert ATOM 11 N1 A 2 27 300.402 273.627 303.188 1.00 0.00 N # inserted XXXXXXXXXXXXXXXX # part used to find lines to be replaced ATOM 1 P A 2 27 295.653 270.783 300.135 1.00119.29 P # next line Args: struc_fn (str): path to the main PDB file insert_fn (str): path to the file that will be injected in into the main PDB file Returns: string: text in the PDB format """ struc = RNAStructure(struc_fn) insert = RNAStructure(insert_fn) output = '' for l in struc.lines: inserted = False if l.startswith('ATOM'): idx = l[13:26]#.strip() # P A 2 27 for li in insert.lines: idxi = li[13:26]#.strip() if idx == idxi: ln = l[:30] + li[30:54] + l[54:] + '\n' # only coords replace (!) if verbose: print(l) print(li) print(ln) print() inserted = True output += ln if not inserted: output += l + '\n' inserted = False return output.strip()
[docs] def set_chain_for_struc(struc_fn, chain_id, save_file_inplace=False, skip_ter=True): """Quick & dirty function to set open a fn PDB format, set chain_id and save it to a file. Takes only lines with ATOM and TER.""" txt = '' for line in open(struc_fn): if skip_ter: if line.startswith('ATOM') or line.startswith('TER'): # if TER line is only TER, not like TER atom chain etc # then just keep TER there and don't add any chain to id if line == 'TER': pass else: l = line[:21] + chain_id + line[22:] txt += l else: txt += line else: if line.startswith('ATOM'): l = line[:21] + chain_id + line[22:] txt += l elif line.startswith('TER'): continue else: txt += line if save_file_inplace: with open(struc_fn, 'w') as f: f.write(txt) return txt.strip()
[docs] def load_rnas(path, verbose=True): """Load structural files (via glob) and return a list of RNAStructure objects. Examples:: rnas = rtl.load_rnas('../rna_tools/input/mq/*.pdb') """ rs = [] import glob for f in glob.glob(path): r = RNAStructure(f) rs.append(r) return rs
# main if '__main__' == __name__: f1 = "input/t2-4-ACA.pdb" f2 = "input/to-replace.pdb" r1 = RNAStructure(f1) r2 = RNAStructure(f2) t = replace_atoms(f1, f2) with open('output/replaced.pdb', 'w') as f: f.write(t) fn = "input/1a9l_NMR_1_2_models.pdb" r = RNAStructure(fn) t = r.get_res_text('A', 1) with open('output/1a9l_NMR_1_2_models_R1.pdb', 'w') as f: f.write(t) fn = "input/remarks.pdb" r = RNAStructure(fn) t = r.get_remarks_text() with open('output/remarks_only.pdb', 'w') as f: f.write(t) fn = 'input/image' print('fn:', fn) struc = RNAStructure(fn) print(' pdb?:', struc.is_pdb()) # print( atoms:', struc.get_no_lines()) fn = 'input/na.pdb' s = RNAStructure(fn) print(s.detect_molecule_type()) #res = get_all_res(na) # print 'what is?', what_is(res) # print res print('non standard:', s.check_res_if_std_na()) print('is protein:', s.detect_molecule_type()) fn = 'input/prot.pdb' s = RNAStructure(fn) print('non standard:', s.check_res_if_std_prot()) print('is protein:', s.detect_molecule_type()) fn = 'input/rna-ru.pdb' s = RNAStructure(fn) print('non standard:', s.check_res_if_supid_rna()) print('is protein:', s.detect_molecule_type()) fn = 'input/na_highAtomNum.pdb' print(fn) s = RNAStructure(fn) s.renum_atoms() s.write('output/na_highAtomNum.pdb') fn = 'input/na_solvet_old_format.pdb' print(fn) s = RNAStructure(fn) s.fix_op_atoms() s.remove_hydrogen() s.remove_ion() s.remove_water() s.write('output/na_solvet_old_format.pdb') fn = 'input/na_solvet_old_format.pdb' print(fn) s = RNAStructure(fn) s.std_resn() s.remove_hydrogen() s.remove_ion() s.remove_water() s.write('output/na_solvet_old_format.pdb') #fn = 'input/na_solvet_old_format__.pdb' #s = RNAStructure(fn) # s.std_resn() # s.remove_hydrogen() # s.remove_ion() # s.remove_water() # s.renum_atoms() # s.fix_op_atoms() # s.write('output/na_solvet_old_format__.pdb') fn = 'input/1xjr.pdb' s.std_resn() s.remove_hydrogen() s.remove_ion() s.remove_water() s.renum_atoms() s.fix_op_atoms() s.write('output/1xjr.pdb') fn = 'input/decoy0165_amb.pdb' print(fn) s = RNAStructure(fn) s.std_resn() s.remove_hydrogen() s.remove_ion() s.remove_water() s.renum_atoms() s.fix_O_in_UC() s.fix_op_atoms() s.write('output/decoy0165_amb_clx.pdb') fn = 'input/farna.pdb' print(fn) s = RNAStructure(fn) s.std_resn() s.remove_hydrogen() s.remove_ion() s.remove_water() s.fix_op_atoms() s.renum_atoms() s.write('output/farna.pdb') fn = 'input/farna.pdb' print(fn) r = RNAStructure(fn) print(r.is_mol2()) if True: print('================================================') print ("input/1xjr_clx_fChimera_noIncludeNumbers.mol2") r = RNAStructure("input/1xjr_clx_fChimera_noIncludeNumbers.mol2") print(r.is_mol2()) r.mol2toPDB('/tmp/x.pdb') r = RNAStructure('/tmp/x.pdb') print(r.get_report) r.std_resn() r.remove_hydrogen() r.remove_ion() r.remove_water() r.fix_op_atoms() r.renum_atoms() r.fixU__to__U() r.write("output/1xjr_clx_fChimera_noIncludeNumbers.mol2") if True: r = RNAStructure("input/2du3_prot_bound.mol2") print(r.is_mol2()) outfn = r.mol2toPDB() print(r.get_report) print('================================================') fn = "input/3e5fA-nogtp_processed_zephyr.pdb" r = RNAStructure(fn) print(r.is_mol2()) #outfn = r.mol2toPDB() print(r.is_amber_like()) print(r.get_report) print(r.get_preview()) r.std_resn() print(r.get_preview()) r.remove_hydrogen() r.remove_ion() r.remove_water() #renum_atoms(t, t) #fix_O_in_UC(t, t) #fix_op_atoms(t, t) r.write('output/3e5fA-nogtp_processed_zephyr.pdb') print() fn = "input/1xjr_clx_charmm.pdb" print(fn) s = RNAStructure(fn) s.std_resn() s.remove_hydrogen() s.remove_ion() s.remove_water() s.write('output/1xjr_clx_charmm.pdb') #renum_atoms(t, t) #fix_O_in_UC(t, t) #fix_op_atoms(t, t) print() fn = "input/dna_fconvpdb_charmm22.pdb" print(fn) r = RNAStructure(fn) r.get_preview() r.resn_as_dna() r.remove_hydrogen() r.remove_ion() r.remove_water() r.std_resn() print(r.get_head()) print(r.get_tail()) print(r.get_preview()) r.write("output/dna_fconvpdb_charmm22.pdb") print() fn = "input/1a9l_NMR_1_2_models.pdb" print(fn) r = RNAStructure(fn) r.write("output/1a9l_NMR_1_2_models_lib.pdb") # r.get_text() # get #1 model import doctest doctest.testmod()