Source code for rna_tools.rna_tools_lib

#!/usr/bin/env python
# -*- coding: utf-8 -*-
""" - main lib file, many tools in this lib is using this file."""

from __future__ import print_function

import os
import sys
from collections import OrderedDict
import re
import string
import time
import gzip
import tempfile
import shutil
import subprocess

from import select_pdb_fragment_pymol_style, select_pdb_fragment

import logging
logger = logging.getLogger('rna-pdb-tools')
handler = logging.StreamHandler()
formatter = logging.Formatter('%(asctime)s - %(name)s - %(levelname)s - %(message)s')

# Don't fix OP3, ignore it
ignore_op3 = False

# Settings: what is what in a PDB file
                   "HIS", "ILE", "LEU", "LYS", "MET", "PHE", "PRO", "SER", "THR",
                   "TRP", "TYR", "VAL"]
RES = ['DA', 'DG', 'DT', 'DC']
RES += ['A', 'G', 'U', 'C']

RESS = ['A', 'C', 'G', 'U', 'ADE', 'CYT', 'GUA', 'URY', 'URI', 'U34', 'U31', 'C31', '4SU', 'H2U', 'QUO', 'G7M', '5MU',
        '5MC', 'PSU', '2MG', '1MG', '1MA', 'M2G', '5BU', 'FHU', 'FMU', 'IU', 'OMG', 'OMC', 'OMU', 'A2M', 'A23', 'CCC',
        'I'] + ['RC', 'RU', 'RA', 'RG', 'RT']
DNA = ['DA', 'DG', 'DT', 'DC']
RNA = ['A', 'G', 'U', 'C']
IONS = ['NA', 'MG', 'MN']
HYDROGEN_NAMES = ["H", "H5'", "H5''", "H4'", "H3'", "H2'", "HO2'", "H1'", "H3", "H5", "H6", "H5T", "H41", "1H5'",
                  "2H5'", "HO2'", "1H4", "2H4", "1H2", "2H2", "H1", "H8", "H2", "1H6", "2H6", "HO5'", "H21", "H22",
                  "H61", "H62", "H42", "HO3'", "1H2'", "2HO'", "HO'2", "H2'1", "HO'2", "HO'2", "H2", "H2'1", "H1", "H2",
                  "1H5*", "2H5*", "H4*", "H3*", "H1*", "1H2*", "2HO*", "1H2", "2H2", "1H4", "2H4", "1H6", "2H6", "H1",
                  "H2", "H3", "H5", "H6", "H8", "H5'1", "H5'2", "H3T"]

class PDBFetchError(Exception):

    from Bio.PDB import *
except ImportError:
    print("Biopython is not detected. It is required for some functions.")

[docs]def get_version(currfn='', verbose=False): # dupa """Get version of the tool based on state of the git repository. Return version. If currfn is empty, then the path is '.'. Hmm.. I think it will work. We will see. The version is not printed!""" if currfn == '': path = '.' else: path = os.path.dirname(currfn) if verbose: print('get_version::path', path) if os.path.islink(currfn): # path + os.sep + os.path.basename(__file__)): path = os.path.dirname(os.readlink(path + os.sep + os.path.basename(currfn))) if not path: path = '.' if verbose: print('get_version::path2', path) curr_path = os.getcwd() os.chdir(os.path.abspath(path)) version = str(subprocess.check_output( 'git describe --long --tags --dirty --always', shell=True)) if verbose: print(version, curr_path) os.chdir(curr_path) # go path to original path if version.find('not found') > -1: return ' unknown' # > install git to get versioning based on git' else: return version
[docs]def sort_strings(l): """ Sort the given list in the way that humans expect. """ def convert(text): return int(text) if text.isdigit() else text def alphanum_key(key): return [convert(c) for c in re.split('([0-9]+)', key)] l.sort(key=alphanum_key) return l
[docs]class RNAStructure: """RNAStructure - handles an RNA pdb file. Atributes: fn (string) : filename of the pdb file lines (list) : the PDB file is loaded and ATOM/HETATM/TER/END go to self.lines """ def __init__(self, fn): self.fn = fn = []'The RNARNAStructure report: %s ' % self.fn) self.mol2_format = False self.lines = [] lines = open(fn).read().strip().split('\n') self.has_many_models = False for l in lines: # multi-models pdb files if l.startswith('MODEL'): self.has_many_models = True if l.startswith('ENDMDL'): break if l.startswith('ATOM') or l.startswith('HETATM') or l.startswith('TER') or l.startswith('END'): self.lines.append(l.strip()) if l.startswith("@<TRIPOS>"): self.mol2_format = True'This is mol2 format') self.res = self.get_resn_uniq()
[docs] def is_pdb(self): """Return True if the files is in PDB format. If self.lines is empty it means that nothing was parsed into the PDB format.""" if len(self.lines): return True else: return False
[docs] def is_nmr(self): """True if the file is an NMR-style multiple model pdb :returns: True or Fo :rtype: boolean """ return self.has_many_models
[docs] def un_nmr(self, startwith1=False, verbose=False): """Un NMR - Split NMR-style multiple model pdb files into individual models. Take self.fn and create new files in the way:: input/1a9l_NMR_1_2_models.pdb input/1a9l_NMR_1_2_models_0.pdb input/1a9l_NMR_1_2_models_1.pdb .. warning:: This function requires biopython. """ parser = PDBParser() structure = parser.get_structure('', self.fn) for c, m in enumerate(structure): if verbose: print(m) io = PDBIO() io.set_structure(m) if startwith1: c += 1'.pdb', '_%i.pdb' % c))
[docs] def is_mol2(self): """Return True if is_mol2 based on the presence of ```@<TRIPOS>```.""" return self.mol2_format
def decap_gtp(self): lines = [] for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): if l[12:16].strip() in ['PG', 'O1G', 'O2G', 'O3G', 'O3B', 'PB', 'O1B', 'O2B', 'O3A']: continue if l[12:16].strip() == 'PA': l = l.replace('PA', 'P ') if l[12:16].strip() == 'O1A': l = l.replace('O1A', 'O1P') if l[12:16].strip() == 'O2A': l = l.replace('O2A', 'O2P') if l[17:20].strip() == 'GTP': l = l[:17] + ' G' + l[20:] l = l.replace('HETATM', 'ATOM ') lines.append(l) self.lines = lines
[docs] def is_amber_like(self): """Use self.lines and check if there is XX line """ for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): rn = l[17:20] if rn in ['RU5', 'RC5', 'RA5', 'RT5', 'RG5']:'This is amber-like format') return True return False
def replace_hetatm(self): nlines = [] for l in self.lines: l = l.replace('HETATM', 'ATOM ') nlines.append(l) self.lines = nlines
[docs] def fix_with_qrnas(self, outfn="", verbose=False): """Add missing heavy atom. A residue is recognized base on a residue names. Copy QRNAS folder to curr folder, run QRNAS and remove QRNAS. .. warning:: QRNAS required ( """ from rpt_config import QRNAS_PATH # prepare folder get ff folder to_go = os.path.abspath(os.path.dirname(self.fn)) curr = os.getcwd() # set occupancy to 0 s = RNAStructure(self.fn) s.set_occupancy_atoms(0.00) s.write(self.fn) os.chdir(to_go) try: shutil.copytree(QRNAS_PATH, to_go + os.sep + "QRNAS") except OSError: pass # prepare config file with open('qrna_config.txt', 'w') as f: f.write("WRITEFREQ 1\n") f.write("NSTEPS 1\n") # run qrnas print('QRNAS...') if not outfn: cmd = "QRNAS -c qrna_config.txt -i " + os.path.basename(self.fn) else: cmd = "QRNAS -c qrna_config.txt -i " + \ os.path.basename(self.fn) + " -o " + curr + os.sep + outfn #o = subprocess.Popen(cmd, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE) os.system(cmd) if False: out = err = if verbose: print(out) print(err) shutil.rmtree(to_go + os.sep + "QRNAS") # post cleaning if outfn: print('Cleaning...') s = RNAStructure(curr + os.sep + outfn) s.remove_hydrogen() s.std_resn() s.write(curr + os.sep + outfn) os.chdir(curr)
def mol2toPDB(self, outfn=""): try: import pybel except ImportError: print ('pybel is needed for mol2 to pdb convertion') # sys.exit(1) sys.exit(0) if not outfn: outfn = self.fn.replace('.mol2', '.pdb') for mol in pybel.readfile("mol2", self.fn): mol.write("pdb", outfn, overwrite=True) print('outfn: ', outfn)' Converted from mol2 to PDB') return outfn def get_no_lines(self): return len(self.lines)
[docs] def get_text(self, add_end=True): """works on self.lines.""" txt = '' for l in self.lines: if l.startswith('END'): continue # skip end txt += l.strip() + '\n' if add_end: if not l.startswith('END'): txt += 'END' return txt.strip()
def get_chain(self, chain_id='A'): txt = '' for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM') or l.startswith('TER'): if l[21] == chain_id: txt += l.strip() + '\n' # txt += 'TER' return txt.strip() def rename_chain(self, chain_id_old, chain_id_new, debug=True): txt = '' lines = [] for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM') or l.startswith('TER'): # TER try: l[21] except IndexError: continue if l[21] == chain_id_old: l = l[:21] + chain_id_new + l[22:] if debug: print(l) txt += l.strip() + '\n' # ok, actually keep all lines as it was lines.append(l) self.lines = lines return txt def get_resn_uniq(self): res = set() for l in self.lines: r = l[17:20].strip().upper() res.add(r) return res def check_res_if_std_na(self): wrong = [] for r in self.res: if r not in RES: wrong.append(r) return wrong
[docs] def get_seq(self, compact=False, chainfirst=False, fasta=False): """Get seq (v2) gets segments of chains with correct numbering Run:: python input/1ykq_clx.pdb > 1ykq_clx A:101-111 GGAGCUCGCCC > 1ykq_clx B:201-238 GGGCGAGGCCGUGCCAGCUCUUCGGAGCAAUACUCGGC > 6_solution_0 A:1-19 26-113 117-172 GGCGGCAGGUGCUCCCGACGUCGGGAGUUAAAAGGGAAG Chains is ``{'A': {'header': 'A:1-19 26-113 117-172', 'resi': [1, 2, 3, ..., \ 19, 26, 27, ..., 172], 'seq': ['G', 'G', 'C', 'G', ... C', 'G', 'U', 'C']}}`` Chains are in other as the appear in the file. .. warning :: take only ATOM and HETATM lines. """ seq = self.lines[0][19] chains = OrderedDict() resi_prev = None chain_prev = None for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): resi = int(l[22:26]) if resi_prev != resi: resname = l[17:20].strip() chain_curr = l[21] if len(resname) == 'GTP': # DG -> g GTP resname = 'g' if len(resname) > 1: # DG -> g GTP resname = resname[-1].lower() try: chains[chain_curr]['resi'].append(resi) chains[chain_curr]['seq'].append(resname) except KeyError: chains[chain_curr] = {} chains[chain_curr]['resi'] = [] chains[chain_curr]['resi'].append(resi) chains[chain_curr]['seq'] = [] chains[chain_curr]['seq'].append(resname) resi_prev = resi chain_prev = chain_curr for c in list(chains.keys()): header = c + ':' + str(chains[c]['resi'][0]) + '-' # add A:1- for i in range(1, len(chains[c]['resi'])): # start from second element if chains[c]['resi'][i] - chains[c]['resi'][i - 1] > 1: header += '' + str(chains[c]['resi'][i - 1]) + ' ' header += '' + str(chains[c]['resi'][i]) + '-' header += '' + str(chains[c]['resi'][-1]) chains[c]['header'] = header # add -163 (last element) if compact: txt = '' for c in list(chains.keys()): if chainfirst: txt += '' + chains[c]['header'].ljust(15) + ''.join(chains[c]['seq']) + ' ' elif fasta: txt += ''.join(chains[c]['seq']) + ' ' else: txt += ''.join(chains[c]['seq']) + ' # ' + chains[c]['header'] + ' ' return txt.strip() else: txt = '' for c in list(chains.keys()): txt += '> ' + chains[c]['header'] + '\n' txt += ''.join(chains[c]['seq']) + '\n' return txt.strip()
def __get_seq(self): """get_seq DEPRECATED You get `chains` such as: OrderedDict([('A', {'header': 'A:1-47', 'seq': 'CGUGGUUAGGGCCACGUUAAAUAGUUGCUUAAGCCCUAAGCGUUGAU'}), ('B', {'header': 'B:48-58', 'seq': 'AUCAGGUGCAA'})]) .. warning:: take only ATOM and HETATM lines. """ seq = '' curri = int(self.lines[0][22:26]) seq = self.lines[0][19] chains = OrderedDict() curri = -100000000000000000000000000000000 # ugly chain_prev = None for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): resi = int(l[22:26]) if curri != resi: print(l) resname = l[17:20].strip() if len(resname) == 'GTP': # DG -> g GTP resname = 'g' if len(resname) > 1: # DG -> g GTP resname = resname[-1].lower() seq += resname chain_curr = l[21] # if distances between curr res and previevs is bigger than 1, then show it as a fragment if resi - curri > 1 and resi - curri < 100000000000000000000000000000000: # ugly hack print(resi - curri) chains[chain_prev]['header'] += '-' + str(resi_prev) if chain_prev != chain_curr and chain_prev: chains[chain_prev]['header'] += '-' + str(resi_prev) if chaoin_curr in chains: chains[chain_curr]['seq'] += resname else: chains[chain_curr] = dict() chains[chain_curr]['header'] = chain_curr + ':' + str(resi) # resi_prev) chains[chain_curr]['seq'] = resname resi_prev = resi chain_prev = chain_curr curri = resi chains[chain_prev]['header'] += '-' + str(resi_prev) seq = '' for c in list(chains.keys()): seq += '> ' + os.path.basename(self.fn) + ' ' + chains[c]['header'] + '\n' seq += chains[c]['seq'] + '\n' return seq.strip()
[docs] def get_info_chains(self): """return A:3-21 B:22-32 """ seq = '' curri = int(self.lines[0][22:26]) seq = self.lines[0][19] chains = OrderedDict() curri = -100000000000000 # ugly chain_prev = None for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): resi = int(l[22:26]) if curri != resi: resname = l[17:20].strip() if len(resname) == 'GTP': # DG -> g GTP resname = 'g' if len(resname) > 1: # DG -> g GTP resname = resname[-1].lower() seq += resname chain_curr = l[21] if chain_prev != chain_curr and chain_prev: chains[chain_prev]['header'] += '-' + str(resi_prev) if chain_curr in chains: chains[chain_curr]['seq'] += resname else: chains[chain_curr] = dict() chains[chain_curr]['header'] = chain_curr + ':' + str(resi) # resi_prev) chains[chain_curr]['seq'] = resname resi_prev = resi chain_prev = chain_curr curri = resi chains[chain_prev]['header'] += '-' + str(resi_prev) seq = '' for c in list(chains.keys()): seq += chains[c]['header'] + ' ' return seq.strip()
def detect_file_format(self): pass def detect_molecule_type(self): aa = [] na = [] for r in self.res: if r in AMINOACID_CODES: aa.append(r) if r in RESS: na.append(r) aa = float(len(aa)) / len(self.res) na = float(len(na)) / len(self.res) if aa == 0 and na == 0: return 'error' if aa > na: return '>protein< vs na', aa, na else: return 'protein vs >na<', aa, na def get_head(self): return '\n'.join(self.lines[:5]) def get_tail(self): return '\n'.join(self.lines[-5:]) def get_preview(self): t = '\n'.join(self.lines[:5]) t += '\n-------------------------------------------------------------------\n' t += '\n'.join(self.lines[-5:]) return t def remove_hydrogen(self): lines = [] for l in self.lines: if l[77:79].strip() == 'H': continue if l[13:17].strip() in HYDROGEN_NAMES: # if l[12:16].strip().startswith('H'): continue else: # print l[12:16] lines.append(l) self.lines = lines
[docs] def remove_water(self): """Remove HOH and TIP3""" lines = [] for l in self.lines: if l[17:21].strip() in ['HOH', 'TIP3', 'WAT']: continue else: lines.append(l) self.lines = lines
[docs] def remove_ion(self): """ TER 1025 U A 47 HETATM 1026 MG MG A 101 42.664 34.395 50.249 1.00 70.99 MG HETATM 1027 MG MG A 201 47.865 33.919 48.090 1.00 67.09 MG :rtype: object """ lines = [] for l in self.lines: element = l[76:78].strip().upper() element2 = l[17:20].strip().upper() if element in IONS: continue if element2 in IONS: continue else: lines.append(l) self.lines = lines
def fixU__to__U(self): lines = [] for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): rn = l[17:20] rn = rn.replace('G ', ' G') rn = rn.replace('U ', ' U') rn = rn.replace('C ', ' C') rn = rn.replace('A ', ' A') l = l[:16] + ' ' + rn + ' ' + l[21:] # print l.strip() # print l2 #l = l.replace(' U ', ' U ') #l = l.replace(' G ', ' G ') #l = l.replace(' A ', ' A ') #l = l.replace(' C ', ' C ') lines.append(l) print ('fixU__to__U OK')' Fix: U__ -> __U') self.lines = lines def resn_as_dna(self): lines = [] for l in self.lines: if l.startswith('ATOM') or l.startswith('HETATM'): # print l nl = l.replace('DA5', ' DA') # RA should be the last!!!! nl = nl.replace('DA3', ' DA') nl = nl.replace(' DA', ' DA') nl = nl.replace(' rA', ' DA') nl = nl.replace('DC5', ' DC') nl = nl.replace('DC3', ' DC') nl = nl.replace(' DC', ' DC') nl = nl.replace(' rC', ' DC') nl = nl.replace('DG5', ' DG') nl = nl.replace('DG3', ' DG') nl = nl.replace(' DG', ' DG') nl = nl.replace(' rG', ' DG') nl = nl.replace('DU5', ' DU') nl = nl.replace('DU3', ' DU') nl = nl.replace(' DU', ' DU') nl = nl.replace(' rU', ' DU') nl = nl.replace('DT5', ' DT') nl = nl.replace('DT3', ' DT') nl = nl.replace(' DT', ' DT') nl = nl.replace(' rT', ' DT') nl = nl.replace('C5M', 'C7 ') if l[17:20].strip() == 'G': nl = nl[:17] + ' DG' + nl[20:] if l[17:20].strip() == 'C': nl = nl[:17] + ' DC' + nl[20:] if l[17:20].strip() == 'T': nl = nl[:17] + ' DT' + nl[20:] if l[17:20].strip() == 'U': nl = nl[:17] + ' DU' + nl[20:] if l[17:20].strip() == 'A': nl = nl[:17] + ' DA' + nl[20:] lines.append(nl) if l.startswith("END") or l.startswith("TER"): lines.append(l) print ('resn_as_dna')' resn_as_dna') self.lines = lines
[docs] def fix_O_in_UC(self): """.. warning: remove RU names before using this function""" lines = [] for l in self.lines: # if l[12:16].strip() in # if l[12:16].strip().startswith('H'): nl = l.replace('O U', 'O2 U') nl = nl.replace('O C', 'O2 C') lines.append(nl) self.lines = lines
[docs] def fix_op_atoms(self): """Replace OXP' to OPX1, e.g ('O1P' -> 'OP1')""" lines = [] for l in self.lines: nl = l.replace('*', '\'') nl = nl.replace('O1P', 'OP1') nl = nl.replace('O2P', 'OP2') nl = nl.replace('O3P', 'OP3') lines.append(nl) self.lines = lines
[docs] def get_report(self): """ Returns: string: report, messages collected on the way of parsing this file """ return '\n'.join(
def is_rna(self): wrong = [] for r in self.res: if r.upper().strip() in ['RC', 'RU', 'RA', 'RG', 'RT']: if r not in wrong_res: wrong_res.append(r) return wrong_res def check_res_if_std_dna(self): wrong_res = [] for r in self.res: if r.upper().strip() in ['A', 'T', 'C', 'G']: if r not in wrong_res: wrong_res.append(r) return wrong_res def check_res_if_supid_rna(self): wrong_res = [] for r in self.res: if r.upper().strip() in ['RC', 'RU', 'RA', 'RG', 'RT']: if r not in wrong_res: wrong_res.append(r) return wrong_res def is_rna(self): for r in self.res: if r.upper().strip() in ['RC', 'RU', 'RA', 'RG', 'RT']: if r not in wrong_res: wrong_res.append(r) return wrong_res
[docs] def renum_atoms(self): """Renum atoms, from 1 to X for line; ATOM/HETATM""" lines = [] c = 1 for l in self.lines: l = l[:6] + str(c).rjust(5) + l[11:] c += 1 lines.append(l) self.lines = lines
[docs] def std_resn(self): """'Fix' residue names which means to change them to standard, e.g. RA5 -> A Works on self.lines, and returns the result to self.lines. Will change things like:: # URI -> U, URA -> U 1xjr_clx_charmm.pdb:ATOM 101 P URA A 5 58.180 39.153 30.336 1.00 70.94 rp13_Dokholyan_1_URI_CYT_ADE_GUA_hydrogens.pdb:ATOM 82 P URI A 4 501.633 506.561 506.256 1.00 0.00 P """ lines = [] for l in self.lines: nl = l.replace('RA5', ' A') # RA should be the last!!!! nl = nl.replace('RA3', ' A') nl = nl.replace('ADE', ' A') nl = nl.replace(' RA', ' A') nl = nl.replace(' rA', ' A') nl = nl.replace('RC5', ' C') nl = nl.replace('RC3', ' C') nl = nl.replace('CYT', ' C') nl = nl.replace(' RC', ' C') nl = nl.replace(' rC', ' C') nl = nl.replace('RG5', ' G') nl = nl.replace('RG3', ' G') nl = nl.replace('GUA', ' G') nl = nl.replace(' RG', ' G') nl = nl.replace(' rG', ' G') nl = nl.replace('RU5', ' U') nl = nl.replace('RU3', ' U') nl = nl.replace('URA', ' U') nl = nl.replace('URI', ' U') nl = nl.replace('URY', ' U') nl = nl.replace(' RU', ' U') nl = nl.replace(' rU', ' U') nl = nl.replace('RT5', ' T') nl = nl.replace('RT3', ' T') nl = nl.replace('THY', ' T') nl = nl.replace(' RT', ' T') nl = nl.replace(' rT', ' T') lines.append(nl) self.lines = lines
def check_res_if_std_prot(self): wrong = [] for r in self.res: if r not in AMINOACID_CODES: wrong.append(r) return wrong
[docs] def write(self, outfn, v=True): """Write ```self.lines``` to a file (and END file")""" f = open(outfn, 'w') # test if there is anything to write, if not, it's likely that the # file is not a PDB file, e.g. .outCR if not self.lines: raise Exception('Nothing to write. Is the input a PDB file? ', self.fn) for l in self.lines: f.write(l + '\n') if not l.startswith('END'): f.write('END') f.close() if v: print('Write %s' % outfn)
[docs] def get_atom_num(self, line): """Extract atom number from a line of PDB file Arguments: * line = ATOM line from a PDB file Output: * atom number as an integer """ return int(''.join([x for x in line[6:11] if x.isdigit()]))
[docs] def get_res_num(self, line): """Extract residue number from a line of PDB file Arguments: * line = ATOM line from a PDB file Output: * residue number as an integer """ return int(''.join([x for x in line[22:27] if x.isdigit()]))
[docs] def get_res_code(self, line): """Get residue code from a line of a PDB file """ if not line.startswith('ATOM'): return None return line[17:20]
def shift_atom_names(self): nlines = [] for l in self.lines: if l.startswith('ATOM'): atom_name = self.get_atom_code(l) l = self.set_atom_code(l, atom_name) nlines.append(l) self.lines = nlines def prune_elements(self): nlines = [] for l in self.lines: if l.startswith('ATOM'): l = l[:76] + ' ' + l[78:] nlines.append(l) self.lines = nlines
[docs] def get_atom_code(self, line): """Get atom code from a line of a PDB file """ if not line.startswith('ATOM'): return None return line[12:16].replace(' ', '').strip()
[docs] def get_atom_coords(self, line): """Get atom coordinates from a line of a PDB file """ if not line.startswith('ATOM'): return None return tuple(map(float, line[31:54].split()))
def set_line_bfactor(self, line, bfactor): if not line.startswith('ATOM'): return None return line[:60] + (" %5.2f" % bfactor) + line[66:]
[docs] def set_atom_occupancy(self, line, occupancy): """set occupancy for line""" return line[:54] + (" %5.2f" % occupancy) + line[60:]
def set_atom_code(self, line, code): return line[:12] + ' ' + code + ' ' * (3 - len(code)) + line[16:] def set_res_code(self, line, code): return line[:17] + code.rjust(3) + line[21:] def get_chain_id(self, line): return line[21:22]
[docs] def get_all_chain_ids(self): """ Returns: set: chain ids, e.g. set(['A', 'B']) """ chain_ids = set() for l in self.lines: if self.get_chain_id(l): chain_ids.add(self.get_chain_id(l)) return chain_ids
def get_atom_index(self, line): try: return int(line[6:11]) except: return None def set_atom_index(self, line, index): return line[:6] + str(index).rjust(5) + line[11:] def get_res_index(self, line): return int(line[22:26]) def set_res_index(self, line, index): return line[:23] + str(index).rjust(3) + line[26:] def set_chain_id(self, line, chain_id): return line[:21] + chain_id + line[22:]
[docs] def get_rnapuzzle_ready(self, renumber_residues=True, fix_missing_atoms=True, rename_chains=True, report_missing_atoms=True, verbose=True): # :, ready_for="RNAPuzzle"): """Get rnapuzzle (SimRNA) ready structure. Clean up a structure, get current order of atoms. :param renumber_residues: boolean, from 1 to ..., second chain starts from 1 etc. :param fix_missing_atoms: boolean, superimpose motifs from the minilibrary and copy-paste missing atoms, this is super crude, so should be used with caution. Submission format @ Run :func:`rna_tools.rna_tools.lib.RNAStructure.std_resn` before this function to fix names. - 170305 Merged with get_simrna_ready and fixing OP3 terminal added - 170308 Fix missing atoms for bases, and O2' .. image:: ../pngs/fix_missing_o_before_after.png Fig. Add missing O2' atom (before and after). .. image:: ../pngs/fix_missing_superposition.png Fig. The residue to fix is in cyan. The G base from the library in red. Atoms O4', C2', C1' are shared between the sugar (in cyan) and the G base from the library (in red). These atoms are used to superimpose the G base on the sugar, and then all atoms from the base are copied to the residues. .. image:: ../pngs/fix_missing_bases.png **Fig.** Rebuild ACGU base-less. It's not perfect but good enough for some applications. .. warning:: It was only tested with the whole base missing! .. warning:: requires: Biopython""" if verbose: logger.setLevel(logging.DEBUG) try: from Bio import PDB from Bio.PDB import PDBIO import warnings warnings.filterwarnings('ignore', '.*Invalid or missing.*',) warnings.filterwarnings('ignore', '.*with given element *',) except: sys.exit('Error: Install biopython to use this function (pip biopython)') import copy # for debugging #renumber_residues = True # if ready_for == "RNAPuzzle": G_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N9 C8 N7 C5 C6 O6 N1 C2 N2 N3 C4".split() A_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N9 C8 N7 C5 C6 N6 N1 C2 N3 C4".split() U_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N1 C2 O2 N3 C4 O4 C5 C6".split() C_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N1 C2 O2 N3 C4 N4 C5 C6".split() # hmm.. is it the same as RNApuzzle??? # if ready_for == "SimRNA": # G_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N9 C8 N7 C5 C6 O6 N1 C2 N2 N3 C4".split() # A_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N9 C8 N7 C5 C6 N6 N1 C2 N3 C4".split() # U_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N1 C2 O2 N3 C4 O4 C5 C6".split() # C_ATOMS = "P OP1 OP2 O5' C5' C4' O4' C3' O3' C2' O2' C1' N1 C2 O2 N3 C4 N4 C5 C6".split() tf = tempfile.NamedTemporaryFile(delete=False) ftmp = self.write(ftmp, v=False) parser = PDB.PDBParser() struct = parser.get_structure('', ftmp) model = struct[0] s2 = PDB.Structure.Structure( m2 = PDB.Model.Model( chains2 = [] missing = [] fixed = [] protein_chains_remmoved = [] new_chains = list(string.ascii_uppercase) for chain in model.get_list(): logger.debug('chain: %s' % chain) # is it RNA? ############################ protein_like = 0 for c, r in enumerate(chain, 1): if r.resname in AMINOACID_CODES: protein_like += 1 if (protein_like / float(c + 1)) > .8: # 90% protein_chains_remmoved.append(chain.get_id()) # ###################################### res = [] for r in chain: res.append(r) res = copy.copy(res) # start chains from A..BCD. etc if rename_chains: try: = new_chains.pop(0) except ValueError: # ValueError: Cannot change id from `A` to `A`. # The id `A` is already used for a sibling of this entity. # so keep it as it was pass c2 = PDB.Chain.Chain( c = 1 # new chain, goes from 1 !!! if renumber True for r in res: # hack for amber/qrna r.resname = r.resname.strip() if r.resname == 'RC3': r.resname = 'C' if r.resname == 'RU3': r.resname = 'U' if r.resname == 'RG3': r.resname = 'G' if r.resname == 'RA3': r.resname = 'A' if r.resname == 'C3': r.resname = 'C' if r.resname == 'U3': r.resname = 'U' if r.resname == 'G3': r.resname = 'G' if r.resname == 'A3': r.resname = 'A' if r.resname == 'RC5': r.resname = 'C' if r.resname == 'RU5': r.resname = 'U' if r.resname == 'RG5': r.resname = 'G' if r.resname == 'RA5': r.resname = 'A' if r.resname == 'C5': r.resname = 'C' if r.resname == 'U5': r.resname = 'U' if r.resname == 'G5': r.resname = 'G' if r.resname == 'A5': r.resname = 'A' if r.resname.strip() == 'RC': r.resname = 'C' if r.resname.strip() == 'RU': r.resname = 'U' if r.resname.strip() == 'RG': r.resname = 'G' if r.resname.strip() == 'RA': r.resname = 'A' # unmodified rna 2MG -> G and take only G atoms if (r.resname.strip() not in ['C', 'U', 'G', 'A']) and \ (r.resname.strip()[-1] in ['C', 'U', 'G', 'A']): r.resname = r.resname.strip()[-1].strip() r2 = PDB.Residue.Residue(, r.resname.strip(), r.segid) if renumber_residues: = ([0], c,[2]) # renumber residues # # experimental: fixing missing OP3. # Only for the first residues. # if c == 1: # if p_missing p_missing = True # if p_missing: # try: # x = r["O5'"] # = ' P' # = ' P' # x.fullname = ' P' # print "REMARK 000 FIX O5' -> P fix in chain ", # except: # pass for a in r: if == 'P': p_missing = False logger.debug('p_missing %s' % p_missing) if p_missing and fix_missing_atoms: currfn = __file__ if currfn == '': path = '.' else: path = os.path.dirname(currfn) if os.path.islink(currfn): # path + os.sep + os.path.basename(__file__)): path = os.path.dirname(os.readlink( path + os.sep + os.path.basename(currfn))) po3_struc = PDB.PDBParser().get_structure('', path + '/data/PO3_inner.pdb') po3 = [po3_atom for po3_atom in po3_struc[0].get_residues()][0] r_atoms = [r["O4'"], r["C4'"], r["C3'"]] po3_atoms = [po3["O4'"], po3["C4'"], po3["C3'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, po3_atoms) rms = round(sup.rms, 3) sup.apply(po3_struc.get_atoms()) # to all atoms of po3 r.add(po3['P']) r.add(po3['OP1']) r.add(po3['OP2']) try: r.add(po3["O5'"]) except: del r["O5'"] r.add(po3["O5'"]) fixed.append(['add OP3 at the beginning of the chain ',, r, c]) p_missing = False # off this function # save it #io = PDB.PDBIO() #io.set_structure( po3_struc ) #"po3.pdb") # # fix missing O2' # o2p_missing = True for a in r: logger.debug('o2p_missing: %s %s %s' % (r, o2p_missing, if == "O2'": o2p_missing = False logger.debug('o2p_missing: %s', o2p_missing) if o2p_missing and fix_missing_atoms: currfn = __file__ if currfn == '': path = '.' else: path = os.path.dirname(currfn) if os.path.islink(currfn): # path + os.sep + os.path.basename(__file__)): path = os.path.dirname(os.readlink( path + os.sep + os.path.basename(currfn))) o2p_struc = PDB.PDBParser().get_structure('', path + '/data/o2prim.pdb') o2p = [o2p_atom for o2p_atom in o2p_struc[0].get_residues()][0] r_atoms = [r["C3'"], r["C2'"], r["C1'"]] o2p_atoms = [o2p["C3'"], o2p["C2'"], o2p["C1'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, o2p_atoms) rms = round(sup.rms, 3) sup.apply(o2p_struc.get_atoms()) # to all atoms of o2p r.add(o2p["O2'"]) logger.debug('fixing o2p for ' % r) fixed.append(['add O2\' ',, r, c]) o2p_missing = False # off this function # # fix missing C (the whole base at the moment) # if str(r.get_resname()).strip() == "C" and fix_missing_atoms: for a in r: if == "N1": break else: # fix currfn = __file__ if currfn == '': path = '.' else: path = os.path.dirname(currfn) if os.path.islink(currfn): # path + os.sep + os.path.basename(__file__)): path = os.path.dirname(os.readlink( path + os.sep + os.path.basename(currfn))) C_struc = PDB.PDBParser().get_structure('', path + '/data/C.pdb') C = [C_atom for C_atom in C_struc[0].get_residues()][0] r_atoms = [r["O4'"], r["C2'"], r["C1'"]] C_atoms = [C["O4'"], C["C2'"], C["C1'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, C_atoms) rms = round(sup.rms, 3) sup.apply(C_struc.get_atoms()) # to all atoms of C r.add(C["N1"]) r.add(C["C2"]) r.add(C["O2"]) r.add(C["N3"]) r.add(C["C4"]) r.add(C["N4"]) r.add(C["C5"]) r.add(C["C6"]) fixed.append(['add the whole base C',, r, c]) # # fix missing U (the whole base at the moment) # if str(r.get_resname()).strip() == "U" and fix_missing_atoms: for a in r: if == "N1": break else: # fix currfn = __file__ if currfn == '': path = '.' else: path = os.path.dirname(currfn) if os.path.islink(currfn): # path + os.sep + os.path.basename(__file__)): path = os.path.dirname(os.readlink( path + os.sep + os.path.basename(currfn))) U_struc = PDB.PDBParser().get_structure('', path + '/data/U.pdb') U = [U_atom for U_atom in U_struc[0].get_residues()][0] r_atoms = [r["O4'"], r["C2'"], r["C1'"]] U_atoms = [U["O4'"], U["C2'"], U["C1'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, U_atoms) rms = round(sup.rms, 3) sup.apply(U_struc.get_atoms()) # to all atoms of U r.add(U["N1"]) r.add(U["C2"]) r.add(U["O2"]) r.add(U["N3"]) r.add(U["C4"]) r.add(U["O4"]) r.add(U["C5"]) r.add(U["C6"]) fixed.append(['add the whole base U',, r, c]) # # fix missing G (the whole base at the moment) # if str(r.get_resname()).strip() == "G" and fix_missing_atoms: for a in r: if == "N1": break else: # fix currfn = __file__ if currfn == '': path = '.' else: path = os.path.dirname(currfn) if os.path.islink(currfn): # path + os.sep + os.path.basename(__file__)): path = os.path.dirname(os.readlink( path + os.sep + os.path.basename(currfn))) G_struc = PDB.PDBParser().get_structure('', path + '/data/G.pdb') G = [G_atom for G_atom in G_struc[0].get_residues()][0] r_atoms = [r["O4'"], r["C2'"], r["C1'"]] G_atoms = [G["O4'"], G["C2'"], G["C1'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, G_atoms) rms = round(sup.rms, 3) sup.apply(G_struc.get_atoms()) # to all atoms of G r.add(G["N9"]) r.add(G["C8"]) r.add(G["N7"]) r.add(G["C5"]) r.add(G["C6"]) r.add(G["O6"]) r.add(G["N1"]) r.add(G["C2"]) r.add(G["N2"]) r.add(G["N3"]) r.add(G["C4"]) fixed.append(['add the whole base G',, r, c]) # # fix missing A (the whole base at the moment) # if str(r.get_resname()).strip() == "A" and fix_missing_atoms: for a in r: if == "N1": break else: # fix currfn = __file__ if currfn == '': path = '.' else: path = os.path.dirname(currfn) if os.path.islink(currfn): # path + os.sep + os.path.basename(__file__)): path = os.path.dirname(os.readlink( path + os.sep + os.path.basename(currfn))) A_struc = PDB.PDBParser().get_structure('', path + '/data/A.pdb') A = [A_atom for A_atom in A_struc[0].get_residues()][0] r_atoms = [r["O4'"], r["C2'"], r["C1'"]] A_atoms = [A["O4'"], A["C2'"], A["C1'"]] sup = PDB.Superimposer() sup.set_atoms(r_atoms, A_atoms) rms = round(sup.rms, 3) sup.apply(A_struc.get_atoms()) # to all atoms of A r.add(A["N9"]) r.add(A["C8"]) r.add(A["N7"]) r.add(A["C5"]) r.add(A["C6"]) r.add(A["N6"]) r.add(A["N1"]) r.add(A["C2"]) r.add(A["N3"]) r.add(A["C4"]) fixed.append(['add the whole base A',, r, c]) # # strip residues of extra atoms, not in G_ATOMS in this case # if str(r.get_resname()).strip() == "G": for an in G_ATOMS: if c == 1 and ignore_op3: if an in ['P', 'OP1', 'OP2']: continue try: if c == 1 and an == "O5'" and p_missing: r2.add(x) else: r2.add(r[an]) except KeyError: # print 'Missing:', an, r, ' new resi', c missing.append([an,, r, c]) c2.add(r2) elif str(r.get_resname()).strip() == "A": for an in A_ATOMS: if c == 1 and ignore_op3: if an in ['P', 'OP1', 'OP2']: continue try: if c == 1 and an == "O5'" and p_missing: r2.add(x) else: r2.add(r[an]) except KeyError: # print 'Missing:', an, r, ' new resi', c missing.append([an,, r, c]) c2.add(r2) elif str(r.get_resname()).strip() == "C": for an in C_ATOMS: if c == 1 and ignore_op3: if an in ['P', 'OP1', 'OP2']: continue try: if c == 1 and an == "O5'" and p_missing: r2.add(x) else: r2.add(r[an]) except: # print 'Missing:', an, r, ' new resi', c missing.append([an,, r, c]) c2.add(r2) elif str(r.get_resname()).strip() == "U": for an in U_ATOMS: if c == 1 and ignore_op3: if an in ['P', 'OP1', 'OP2']: continue try: if c == 1 and an == "O5'" and p_missing: r2.add(x) else: r2.add(r[an]) except KeyError: # print 'Missing:', an, r,' new resi', c missing.append([an,, r, c]) c2.add(r2) c += 1 chains2.append(c2) io = PDBIO() s2.add(m2) for chain2 in chains2: m2.add(chain2) # print c2 # print m2 io.set_structure(s2) tf = tempfile.NamedTemporaryFile(delete=False) fout = remarks = [] if fixed: remarks.append('REMARK 250 Fixed atoms/residues:') for i in fixed: remarks.append( ' '.join(['REMARK 250 -', str(i[0]), 'in chain:', str(i[1]), str(i[2]), 'residue #', str(i[3])])) if missing and report_missing_atoms: remarks.append('REMARK 250 Missing atoms:') for i in missing: remarks.append(' '.join(['REMARK 250 +', str(i[0]), str(i[1]), str(i[2]), 'residue #', str(i[3])])) #raise Exception('Missing atoms in %s' % self.fn) if protein_chains_remmoved: remarks.append('REMARK 250 Chains that seem to be proteins removed and : ' + ' '.join(protein_chains_remmoved)) # # fix ter 'TER' -> TER 1528 G A 71 # s = RNAStructure(fout) self.lines = s.lines c = 0 # ATOM 1527 C4 G A 71 0.000 0.000 0.000 1.00 0.00 C nlines = [] no_ters = 0 for l in self.lines: ## align atoms to the left ####################################################### # ATOM 3937 P C B 185 11.596 -7.045 26.165 1.00 0.00 P # ATOM 3937 P C B 185 11.596 -7.045 26.165 1.00 0.00 P if l.startswith('ATOM'): atom_code = self.get_atom_code(l) l = self.set_atom_code(l, atom_code) ################################################################################## if l.startswith('TER'): # pass # leave it for now this atom_l = self.lines[c - 1] new_l = 'TER'.ljust(80) # TER 1528 G A 71 <<<' new_l = self.set_atom_index(new_l, str(self.get_atom_index(atom_l) + 1 + no_ters)) new_l = self.set_res_code(new_l, self.get_res_code(atom_l)) new_l = self.set_chain_id(new_l, self.get_chain_id(atom_l)) new_l = self.set_res_index(new_l, self.get_res_index(atom_l)) nlines.append(new_l) #nlines.append(l) no_ters += 1 else: if self.get_atom_index(l): l = self.set_atom_index(l, self.get_atom_index( l) + no_ters) # 1 ter +1 2 ters +2 etc nlines.append(l) c += 1 self.lines = nlines return remarks
[docs] def set_occupancy_atoms(self, occupancy): """ :param occupancy: """ nlines = [] for l in self.lines: if l.startswith('ATOM'): l = self.set_atom_occupancy(l, 0.00) nlines.append(l) else: nlines.append(l) self.lines = nlines
[docs] def edit_occupancy_of_pdb(txt, pdb, pdb_out, v=False): """Make all atoms 1 (flexi) and then set occupancy 0 for seletected atoms. Return False if error. True if OK """ struc = PDB.PDBParser().get_structure('struc', pdb) txt = txt.replace(' ', '') if v: print (txt) l = re.split('[,:;]', txt) if v: print (l) for s in struc: for c in s: for r in c: for a in r: a.set_occupancy(1) # make it flaxi for i in l: # ['A', '1-10', '15', '25-30', 'B', '1-10'] if i in string.ascii_letters: if v: print('chain', i) chain_curr = i continue if i.find('-') > -1: start, ends = i.split('-') if start > ends: print('Error: range start > end ' + i) # >>sys.stderr return False index = list(range(int(start), int(ends) + 1)) else: index = [int(i)] for i in index: # change b_factor try: atoms = struc[0][chain_curr][i] except KeyError: if i == chain_curr: print('Error: Chain ' + chain_curr + ' not found in the PDB structure') # >>sys.stderr, else: print('Error: Residue ' + chain_curr + ':' + str(i) + ' found in the PDB structure') # >>sys.stderr, return False for a in atoms: a.set_occupancy(0) io = PDBIO() io.set_structure(struc) print('Saved ', pdb_out) return True
def view(self): os.system('pymol ' + self.fn)
[docs] def remove(self, verbose): """Delete file, self.fn""" os.remove(self.fn) if verbose: 'File %s removed' % self.fn
def __repr__(self): return 'RNAStructure %s' % self.fn
def add_header(version=None): now = time.strftime("%c") txt = 'REMARK 250 Model edited with rna-tools\n' txt += 'REMARK 250 ver %s \nREMARK 250 \nREMARK 250 %s' % ( version, now) return txt
[docs]def edit_pdb(f, args): """Edit your structure. The function can take ``A:3-21>A:1-19`` or even syntax like this ``A:3-21>A:1-19,B:22-32>B:20-30`` and will do an editing. The output is printed, line by line. Only ATOM lines are edited! Examples:: $ --edit 'A:3-21>A:1-19' 1f27_clean.pdb > 1f27_clean_A1-19.pdb or even:: $ --edit 'A:3-21>A:1-19,B:22-32>B:20-30' 1f27_clean.pdb > 1f27_clean_renumb.pdb """ # open a new file s = RNAStructure(f) output = '' if not args.no_hr: output += add_header() + '\n' output += 'REMARK 250 HEADER --edit ' + args.edit + '\n' # --edit 'A:3-21>A:1-19,B:22-32>B:20-30' if args.edit.find(',') > -1: # more than one edits edits = args.edit.split(',') # ['A:3-21>A:1-19', 'B:22-32>B:20-30'] selects = [] for e in edits: selection_from, selection_to = select_pdb_fragment( e.split('>')[0]), select_pdb_fragment(e.split('>')[1]) if len(selection_to) != len(selection_from): raise Exception('len(selection_to) != len(selection_from)') selects.append([selection_from, selection_to]) output += edits else: # one edit e = args.edit selection_from, selection_to = select_pdb_fragment( e.split('>')[0]), select_pdb_fragment(e.split('>')[1]) if len(selection_to) != len(selection_from): raise Exception('len(selection_to) != len(selection_from)') selects = [[selection_from, selection_to]] # go ever all edits: ['A:3-21>A:1-19','B:22-32>B:20-30'] for l in s.lines: if l.startswith('ATOM'): # get chain and resi chain = l[21:22].strip() resi = int(l[22:26].strip()) if_selected_dont_print = False # for selections for select in selects: selection_from, selection_to = select if chain in selection_from: if resi in selection_from[chain]: # [1,2,3] mapping from [4,5,10], you want to know how to map 1 # 1 is [0] element of first list, so you have to index first list # to get 0, with this 0 you can get 4 out of second list [4,5,10][0] -> 4 nl = list(l) chain_new = list(selection_to.keys())[0] # chain form second list nl[21] = chain_new # new chain index = selection_from[chain].index(int(resi)) # get index of 1 resi_new = str(selection_to[chain_new][index]).rjust( 4) # 'A' [1,2,3] -> ' 1' nl[22:26] = resi_new nl = ''.join(nl) if_selected_dont_print = True output += nl + '\n' if not if_selected_dont_print: output += l + '\n' else: # if not atom output += l + '\n' return output
[docs]def collapsed_view(args): """Collapsed view of pdb file. Only lines with C5' atoms are shown and TER, MODEL, END. example:: [mm] rna_tools git:(master) $ python --cv input/1f27.pdb ATOM 1 C5' A A 3 25.674 19.091 3.459 1.00 16.99 C ATOM 23 C5' C A 4 19.700 19.206 5.034 1.00 12.65 C ATOM 43 C5' C A 5 14.537 16.130 6.444 1.00 8.74 C ATOM 63 C5' G A 6 11.726 11.579 9.544 1.00 9.81 C ATOM 86 C5' U A 7 12.007 7.281 13.726 1.00 11.35 C ATOM 106 C5' C A 8 12.087 6.601 18.999 1.00 12.74 C TER""" r = RNAStructure(args.file) for l in r.lines: at = r.get_atom_code(l) if at == "C5'": print(l) if l.startswith('TER') or l.startswith('MODEL') or l.startswith('END'): print(l)
[docs]def fetch(pdb_id, path="."): """fetch pdb file from""" import urllib3 http = urllib3.PoolManager() # try: pdb_id = pdb_id.replace('.pdb', '') response = http.request('GET', '' + pdb_id + '.pdb') if not response.status == 200: raise PDBFetchError() # except urllib3.HTTPError: # raise Exception('The PDB does not exists: ' + pdb_id) txt = if path != '.': npath = path + os.sep + pdb_id + '.pdb' else: npath = pdb_id + '.pdb' print('downloading... ' + npath) with open(npath, 'wb') as f: f.write(txt) print('ok') return npath
[docs]def fetch_ba(pdb_id, path="."): """fetch biological assembly pdb file from >>> fetch_ba('1xjr') ... """ try: import urllib3 except ImportError: print('urllib3 is required') return http = urllib3.PoolManager() # try: response = http.request('GET', url='' + pdb_id.lower() + '.pdb1') if not response.status == 200: raise PDBFetchError() txt = npath = path + os.sep + pdb_id + '_ba.pdb' print('downloading...' + npath) with open(npath, 'wb') as f: f.write(txt) print('ok') return pdb_id + '_ba.pdb'
[docs]def fetch_cif_ba(cif_id, path="."): """fetch biological assembly cif file from""" import urrlib3 http = urllib3.PoolManager() # try: response = http.request('GET', url='' + cif_id.lower() + '-assembly1.cif') if not response.status == 200: raise PDBFetchError() txt = npath = path + os.sep + cif_id + '_ba.cif' print('downloading...' + npath) with open(npath, 'wb') as f: f.write(txt) print('ok') return cif_id + '_ba.cif'
[docs]def replace_chain(struc_fn, insert_fn, chain_id): """Replace chain of the main file (struc_fn) with some new chain (insert_fn) of given chain id. Args: struc_fn (str): path to the main PDB file insert_fn (str): path to the file that will be injected in into the main PDB file chain_id (str): chain that will be inserted into the main PDB file Returns: string: text in the PDB format """ struc = RNAStructure(struc_fn) insert = RNAStructure(insert_fn) output = '' inserted = False for l in struc.lines: if l.startswith('ATOM'): chain = l[21] if chain == chain_id: if not inserted: for insertl in insert.lines: if not insertl.startswith('HEADER') and not insertl.startswith('END'): output += insertl + '\n' inserted = True continue # insert pdb output += l + '\n' return output.strip()
# main if '__main__' == __name__: fn = 'input/image' print('fn:', fn) struc = RNAStructure(fn) print(' pdb?:', struc.is_pdb()) # print( atoms:', struc.get_no_lines()) fn = 'input/na.pdb' s = RNAStructure(fn) print(s.detect_molecule_type()) #res = get_all_res(na) # print 'what is?', what_is(res) # print res print('non standard:', s.check_res_if_std_na()) print('is protein:', s.detect_molecule_type()) fn = 'input/prot.pdb' s = RNAStructure(fn) print('non standard:', s.check_res_if_std_prot()) print('is protein:', s.detect_molecule_type()) fn = 'input/rna-ru.pdb' s = RNAStructure(fn) print('non standard:', s.check_res_if_supid_rna()) print('is protein:', s.detect_molecule_type()) fn = 'input/na_highAtomNum.pdb' print(fn) s = RNAStructure(fn) s.renum_atoms() s.write('output/na_highAtomNum.pdb') fn = 'input/na_solvet_old_format.pdb' print(fn) s = RNAStructure(fn) s.fix_op_atoms() s.remove_hydrogen() s.remove_ion() s.remove_water() s.write('output/na_solvet_old_format.pdb') fn = 'input/na_solvet_old_format.pdb' print(fn) s = RNAStructure(fn) s.std_resn() s.remove_hydrogen() s.remove_ion() s.remove_water() s.write('output/na_solvet_old_format.pdb') #fn = 'input/na_solvet_old_format__.pdb' #s = RNAStructure(fn) # s.std_resn() # s.remove_hydrogen() # s.remove_ion() # s.remove_water() # s.renum_atoms() # s.fix_op_atoms() # s.write('output/na_solvet_old_format__.pdb') fn = 'input/1xjr.pdb' s.std_resn() s.remove_hydrogen() s.remove_ion() s.remove_water() s.renum_atoms() s.fix_op_atoms() s.write('output/1xjr.pdb') fn = 'input/decoy0165_amb.pdb' print(fn) s = RNAStructure(fn) s.std_resn() s.remove_hydrogen() s.remove_ion() s.remove_water() s.renum_atoms() s.fix_O_in_UC() s.fix_op_atoms() s.write('output/decoy0165_amb_clx.pdb') fn = 'input/farna.pdb' print(fn) s = RNAStructure(fn) s.std_resn() s.remove_hydrogen() s.remove_ion() s.remove_water() s.fix_op_atoms() s.renum_atoms() s.write('output/farna.pdb') fn = 'input/farna.pdb' print(fn) r = RNAStructure(fn) print(r.is_mol2()) if True: print('================================================') print ("input/1xjr_clx_fChimera_noIncludeNumbers.mol2") r = RNAStructure("input/1xjr_clx_fChimera_noIncludeNumbers.mol2") print(r.is_mol2()) r.mol2toPDB('/tmp/x.pdb') r = RNAStructure('/tmp/x.pdb') print(r.get_report) r.std_resn() r.remove_hydrogen() r.remove_ion() r.remove_water() r.fix_op_atoms() r.renum_atoms() r.fixU__to__U() r.write("output/1xjr_clx_fChimera_noIncludeNumbers.mol2") if True: r = RNAStructure("input/2du3_prot_bound.mol2") print(r.is_mol2()) outfn = r.mol2toPDB() print(r.get_report) print('================================================') fn = "input/3e5fA-nogtp_processed_zephyr.pdb" r = RNAStructure(fn) print(r.is_mol2()) #outfn = r.mol2toPDB() print(r.is_amber_like()) print(r.get_report) print(r.get_preview()) r.std_resn() print(r.get_preview()) r.remove_hydrogen() r.remove_ion() r.remove_water() #renum_atoms(t, t) #fix_O_in_UC(t, t) #fix_op_atoms(t, t) r.write('output/3e5fA-nogtp_processed_zephyr.pdb') print() fn = "input/1xjr_clx_charmm.pdb" print(fn) s = RNAStructure(fn) s.std_resn() s.remove_hydrogen() s.remove_ion() s.remove_water() s.write('output/1xjr_clx_charmm.pdb') #renum_atoms(t, t) #fix_O_in_UC(t, t) #fix_op_atoms(t, t) print() fn = "input/dna_fconvpdb_charmm22.pdb" print(fn) r = RNAStructure(fn) r.get_preview() r.resn_as_dna() r.remove_hydrogen() r.remove_ion() r.remove_water() r.std_resn() print(r.get_head()) print(r.get_tail()) print(r.get_preview()) r.write("output/dna_fconvpdb_charmm22.pdb") print() fn = "input/1a9l_NMR_1_2_models.pdb" print(fn) r = RNAStructure(fn) r.write("output/1a9l_NMR_1_2_models_lib.pdb") # r.get_text() # get #1 model import doctest doctest.testmod()