Source code for rna_tools.RfamSearch

#!/usr/bin/env python
import subprocess
import tempfile

from rna_tools.Seq import RNASequence
from rna_tools.rna_tools_config import RFAM_DB_PATH

[docs]class RfamSearchError(Exception): pass
[docs]class RfamSearch(): """RfamSearch (local). Rfam is a collection of multiple sequence alignments and covariance models representing non-coding RNA families. Rfam is available on the web The website allow the user to search a query sequence against a library of covariance models, and view multiple sequence alignments and family annotation. The database can also be downloaded in flatfile form and searched locally using the INFERNAL package ( The first release of Rfam (1.0) contains 25 families, which annotate over 50 000 non-coding RNA genes in the taxonomic divisions of the EMBL nucleotide database. Infernal ("INFERence of RNA ALignment") is for searching DNA sequence databases for RNA structure and sequence similarities. It is an implementation of a special case of profile stochastic context-free grammars called covariance models (CMs). A CM is like a sequence profile, but it scores a combination of sequence consensus and RNA secondary structure consensus, so in many cases, it is more capable of identifying RNA homologs that conserve their secondary structure more than their primary sequence. Infernal `cmscan` is used to search the CM-format Rfam database. Setup: - download the database from (file:, ~30mb) - install - set up ``RFAM_DB_PATH`` in the config file of rna-pdb-tools. Cite: Nawrocki and S. R. Eddy, Infernal 1.1: 100-fold faster RNA homology searches, Bioinformatics 29:2933-2935 (2013). """ # noqa def __init__(self): pass
[docs] def cmscan(self, seq): """Run cmscan on the seq. Usage:: >>> seq = RNASequence("GGCGCGGCACCGUCCGCGGAACAAACGG") >>> rs = RfamSearch() >>> hit = rs.cmscan(seq) >>> print(hit) #doctest: +ELLIPSIS # cmscan :: search sequence(s) against a CM database... :param seq: string :returns: result :rtype: string """ # make tmp file tf = tempfile.NamedTemporaryFile(delete=False) += '.fa' with open(, 'w') as f: f.write('>target\n') f.write(seq.seq + '\n') # make output file of = tempfile.NamedTemporaryFile(delete=False) # run cmscan cmd = 'cmscan -E 1 ' + RFAM_DB_PATH + ' ' + + ' > ' + o = subprocess.Popen( cmd, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE) # out = err = if err: raise RfamSearchError(err) self.output = open( # os.chdir(old_pwd) return self.output
# main if __name__ == '__main__': seq = RNASequence("GGCGCGGCACCGUCCGCGGAACAAACGG") rs = RfamSearch() hit = rs.cmscan(seq) print(hit) import doctest doctest.testmod()