rna-pdb-tools

rna-pdb-tools is the main code of this library.

Get RNAPuzzle ready

Get sequence

Example:

$ rna_pdb_tools.py --get_seq 5_solution_1.pdb
> 5_solution_1.pdb A:1-576
CAUCCGGUAUCCCAAGACAAUCUCGGGUUGGGUUGGGAAGUAUCAUGGCUAAUCACCAUGAUGCAAUCGGGUUGAACACUUAAUUGGGUUAAAACGGUGGGGGACGAUCCCGUAACAUCCGUCCUAACGGCGACAGACUGCACGGCCCUGCCUCAGGUGUGUCCAAUGAACAGUCGUUCCGAAAGGAAG

Fetch

Example:

$ rna_pdb_tools.py --fetch 1xjr
downloading...1xjr ok

Fetch Biological Assembly

Example:

$ rna_pdb_tools.py --fetch_ba 1xjr
downloading...1xjr_ba.pdb ok

or over a list of pdb ids in a text file:

$ cat data/pdb_ids.txt
1y26
1fir

$ while read p; do rna_pdb_tools.py --fetch_ba $p; done < data/pdb_ids.txt
downloading...1y26_ba.pdb ok
downloading...1fir_ba.pdb ok

$ ls *.pdb
1fir_ba.pdb 1y26_ba.pdb

Delete

Examples:

$ for i in `ls *pdb`; do rna_pdb_tools.py --delete A:46-56 $i > ../rpr_rm_loop/$i ; done

go over all files in the current directory, remove a fragment of chain A, residues between 46-56 (including them) and save outputs to in the folder rpr_rm_loops.

Edit

The library